Starting /dee2/code/volunteer_pipeline.sh SRR6322348 current disk space = 1544148664320 free memory = 1597580688 SRR6322348 SRAfilesize 59f436d0f71db68b7924bf9c5d8f92cf SRR6322348.sra SRR6322348.sra file validated SRR6322348 is single end SRR6322348 is conventional basespace SRR6322348 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80375 32.0 32.0 32.0 32.0 32.0 2 31.52875 32.0 32.0 32.0 32.0 32.0 3 35.77375 37.0 37.0 37.0 32.0 37.0 4 36.33875 37.0 37.0 37.0 37.0 37.0 5 36.6925 37.0 37.0 37.0 37.0 37.0 6 40.42375 41.0 41.0 41.0 41.0 41.0 7 40.243 41.0 41.0 41.0 41.0 41.0 8 33.5975 37.0 32.0 41.0 12.0 41.0 9 37.693 41.0 37.0 41.0 32.0 41.0 10 35.07175 41.0 32.0 41.0 22.0 41.0 11 39.86 41.0 41.0 41.0 37.0 41.0 12 38.9315 41.0 41.0 41.0 32.0 41.0 13 36.37875 41.0 37.0 41.0 27.0 41.0 14 36.15825 41.0 37.0 41.0 22.0 41.0 15 39.54675 41.0 41.0 41.0 37.0 41.0 16 36.086 41.0 37.0 41.0 22.0 41.0 17 40.098 41.0 41.0 41.0 37.0 41.0 18 40.48225 41.0 41.0 41.0 41.0 41.0 19 36.69325 41.0 37.0 41.0 27.0 41.0 20 39.3355 41.0 41.0 41.0 37.0 41.0 21 39.312 41.0 41.0 41.0 37.0 41.0 22 36.928 41.0 37.0 41.0 27.0 41.0 23 39.411 41.0 41.0 41.0 37.0 41.0 24 40.37575 41.0 41.0 41.0 41.0 41.0 25 35.0475 41.0 32.0 41.0 22.0 41.0 26 39.286 41.0 41.0 41.0 37.0 41.0 27 30.74825 37.0 22.0 41.0 12.0 41.0 28 37.111 41.0 37.0 41.0 27.0 41.0 29 39.1595 41.0 41.0 41.0 37.0 41.0 30 39.86525 41.0 41.0 41.0 37.0 41.0 31 34.40725 41.0 32.0 41.0 12.0 41.0 32 32.44275 37.0 27.0 41.0 12.0 41.0 33 31.21125 37.0 22.0 41.0 12.0 41.0 34 33.69275 37.0 27.0 41.0 12.0 41.0 35 38.03825 41.0 37.0 41.0 32.0 41.0 36 26.48325 27.0 12.0 37.0 12.0 41.0 37 30.01625 32.0 22.0 41.0 12.0 41.0 38 23.46175 22.0 12.0 37.0 12.0 41.0 39 23.7295 22.0 12.0 32.0 12.0 37.0 40 32.85975 37.0 27.0 41.0 22.0 41.0 41 38.4285 41.0 37.0 41.0 32.0 41.0 42 34.10225 41.0 32.0 41.0 12.0 41.0 43 25.7 27.0 12.0 37.0 12.0 41.0 44 24.83575 22.0 12.0 37.0 12.0 41.0 45 22.02425 22.0 12.0 32.0 12.0 37.0 46 29.069 32.0 22.0 37.0 12.0 41.0 47 24.72525 27.0 12.0 37.0 12.0 41.0 48 36.2595 37.0 37.0 41.0 27.0 41.0 49 38.644 41.0 37.0 41.0 32.0 41.0 50 39.874 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 5.0 24 5.0 25 11.0 26 31.0 27 50.0 28 71.0 29 96.0 30 143.0 31 187.0 32 296.0 33 397.0 34 547.0 35 614.0 36 632.0 37 502.0 38 294.0 39 99.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65 8.05 6.525 42.775 2 23.673673673673672 10.085085085085085 35.86086086086086 30.38038038038038 3 22.900000000000002 13.450000000000001 23.175 40.475 4 27.450000000000003 20.95 21.25 30.349999999999998 5 27.125 26.075 23.9 22.900000000000002 6 25.4 28.95 23.35 22.3 7 18.275 22.55 40.6 18.575 8 24.9 21.6 29.525000000000002 23.974999999999998 9 21.45 21.825 33.675 23.05 10 23.45 32.95 24.425 19.175 11 25.0 25.525 24.9 24.575 12 24.575 22.825 26.35 26.25 13 26.474999999999998 24.3 25.25 23.974999999999998 14 23.5 26.275 25.224999999999998 25.0 15 22.325 25.724999999999998 26.5 25.45 16 26.025 25.2 23.225 25.55 17 23.525 24.325 25.85 26.3 18 22.35 25.35 26.424999999999997 25.874999999999996 19 27.275 24.675 22.7 25.35 20 21.725 25.75 27.400000000000002 25.124999999999996 21 23.875 24.9 25.924999999999997 25.3 22 25.124999999999996 25.650000000000002 24.474999999999998 24.75 23 22.175 28.125 24.525 25.174999999999997 24 23.575 25.15 25.825 25.45 25 26.625 24.575 24.05 24.75 26 22.725 24.875 27.250000000000004 25.15 27 27.250000000000004 24.55 23.75 24.45 28 23.225 24.625 27.35 24.8 29 23.200000000000003 24.9 27.35 24.55 30 23.05 24.55 25.674999999999997 26.724999999999998 31 26.474999999999998 25.1 23.275000000000002 25.15 32 25.825 24.0 24.349999999999998 25.825 33 25.1 24.775 24.95 25.174999999999997 34 23.974999999999998 25.95 25.1 24.975 35 24.037018509254626 24.312156078039017 26.8384192096048 24.81240620310155 36 29.075 21.775 26.55 22.6 37 27.875 24.6 23.549999999999997 23.974999999999998 38 28.075 23.75 25.75 22.425 39 28.1 23.799999999999997 24.975 23.125 40 23.849999999999998 25.424999999999997 24.85 25.874999999999996 41 23.200000000000003 23.875 27.375 25.55 42 24.5 24.775 25.424999999999997 25.3 43 28.825 22.775000000000002 26.724999999999998 21.675 44 28.625 24.675 24.474999999999998 22.225 45 29.2 24.349999999999998 26.200000000000003 20.25 46 26.424999999999997 24.2 24.575 24.8 47 27.53188297074269 24.18104526131533 25.906476619154787 22.380595148787197 48 22.55 25.174999999999997 25.825 26.450000000000003 49 23.225 24.9 25.1 26.775 50 21.796796796796798 25.625625625625624 27.002002002002 25.575575575575577 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.5 24 5.0 25 5.0 26 5.0 27 5.0 28 5.0 29 11.0 30 17.0 31 29.5 32 42.0 33 54.0 34 66.0 35 79.5 36 93.0 37 112.5 38 132.0 39 174.0 40 216.0 41 252.0 42 288.0 43 295.0 44 302.0 45 317.5 46 333.0 47 339.0 48 345.0 49 350.0 50 355.0 51 341.0 52 327.0 53 324.5 54 322.0 55 282.0 56 242.0 57 222.5 58 203.0 59 183.5 60 164.0 61 149.5 62 135.0 63 128.0 64 121.0 65 103.0 66 85.0 67 69.0 68 53.0 69 57.5 70 62.0 71 43.0 72 24.0 73 24.5 74 25.0 75 20.5 76 16.0 77 13.0 78 10.0 79 6.5 80 3.0 81 3.0 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.05 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.0 49 0.0 50 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7818411097099622 1.55 3 0.0 0.0 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885993 READS because READLEN < 1 Read 885993 spots for SRR6322348.sra Written 885993 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Written 885988 spots for SRR6322348.sra Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra Rejected 885988 READS because READLEN < 1 Read 885988 spots for SRR6322348.sra Written 885988 spots for SRR6322348.sra SRR ids: ['SRR6322348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ridsp1y2 SRR6322348.sra spots: 17719765 blocks: [[1, 885988], [885989, 1771976], [1771977, 2657964], [2657965, 3543952], [3543953, 4429940], [4429941, 5315928], [5315929, 6201916], [6201917, 7087904], [7087905, 7973892], [7973893, 8859880], [8859881, 9745868], [9745869, 10631856], [10631857, 11517844], [11517845, 12403832], [12403833, 13289820], [13289821, 14175808], [14175809, 15061796], [15061797, 15947784], [15947785, 16833772], [16833773, 17719765]] SRR6322348 file size 2470141 SRR6322348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322348 SRR6322348_1.fastq Input file: SRR6322348_1.fastq trimmed: SRR6322348-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:40:25 2024 >> started Sat Dec 7 09:40:34 2024 >> done (8.907s) 17719765 reads processed; of these: 237 ( 0.00%) short reads filtered out after trimming by size control 41174 ( 0.23%) empty reads filtered out after trimming by size control 17678354 (99.77%) reads available; of these: 1243 ( 0.01%) trimmed reads available after processing 17677111 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1232 0.01% 50 17677111 99.99% 17678354 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.31 fanout-score-rank=16 prefix-density=0.09 prefix-fanout=4.4 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=133.73 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=18.0 sequence=TCTTCTTCTTCCT Started job on | Dec 07 09:40:45 Started mapping on | Dec 07 09:40:45 Finished on | Dec 07 09:41:00 Mapping speed, Million of reads per hour | 4242.80 Number of input reads | 17678354 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16846168 Uniquely mapped reads % | 95.29% Average mapped length | 49.84 Number of splices: Total | 2658512 Number of splices: Annotated (sjdb) | 2572768 Number of splices: GT/AG | 2624692 Number of splices: GC/AG | 29403 Number of splices: AT/AC | 1858 Number of splices: Non-canonical | 2559 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 618719 % of reads mapped to multiple loci | 3.50% Number of reads mapped to too many loci | 58077 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 213467 213467 213467 N_multimapping 618719 618719 618719 N_noFeature 718586 16532363 815394 N_ambiguous 233576 1477 16800 UnstrandedReadsAssigned:15894006 PositiveStrandReadsAssigned:312328 NegativeStrandReadsAssigned:16013974 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322348 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322348-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,678,354 reads, 16,070,183 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6322348.ke.tsv 35125 SRR6322348.se.tsv 88098 total ==> SRR6322348.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 124.188 16.4958 PNS24247 1044 945 54.1152 6.3666 PNS24249 1928 1829 33.7467 2.05134 PNS24246 1044 945 54.1152 6.3666 PNS24248 1044 945 54.1152 6.3666 PNS24244 1471 1372 133.72 10.8358 PNS24243 293 194 0 0 KQK14069 1603 1504 13.3147 0.984249 KQK14071 474 375 9.00594 2.67004 ==> SRR6322348.se.tsv <== BRADI_1g14170v3 27 BRADI_1g53295v3 45 BRADI_1g59795v3 433 BRADI_1g07683v3 0 BRADI_1g00485v3 183 BRADI_1g20270v3 1600 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR6322348 completed mapping pipeline successfully