Starting /dee2/code/volunteer_pipeline.sh SRR6322349 current disk space = 1542928916480 free memory = 1602687084 SRR6322349 SRAfilesize c424f2bd1ba5e4a0f582d3f3e59e767e SRR6322349.sra SRR6322349.sra file validated SRR6322349 is single end SRR6322349 is conventional basespace SRR6322349 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.64 32.0 32.0 32.0 32.0 32.0 2 25.96 32.0 12.0 32.0 12.0 32.0 3 33.675 32.0 32.0 37.0 32.0 37.0 4 35.4425 37.0 37.0 37.0 32.0 37.0 5 36.53875 37.0 37.0 37.0 37.0 37.0 6 40.06375 41.0 41.0 41.0 37.0 41.0 7 32.221 37.0 27.0 41.0 12.0 41.0 8 38.697 41.0 37.0 41.0 32.0 41.0 9 38.832 41.0 37.0 41.0 32.0 41.0 10 40.166 41.0 41.0 41.0 37.0 41.0 11 40.3685 41.0 41.0 41.0 41.0 41.0 12 40.13625 41.0 41.0 41.0 37.0 41.0 13 39.06675 41.0 41.0 41.0 37.0 41.0 14 38.25425 41.0 37.0 41.0 32.0 41.0 15 39.41325 41.0 41.0 41.0 37.0 41.0 16 36.22625 41.0 37.0 41.0 22.0 41.0 17 39.62975 41.0 41.0 41.0 37.0 41.0 18 40.3925 41.0 41.0 41.0 41.0 41.0 19 40.11175 41.0 41.0 41.0 37.0 41.0 20 36.54275 41.0 37.0 41.0 27.0 41.0 21 39.85325 41.0 41.0 41.0 37.0 41.0 22 40.09825 41.0 41.0 41.0 37.0 41.0 23 38.4065 41.0 37.0 41.0 32.0 41.0 24 40.00975 41.0 41.0 41.0 37.0 41.0 25 34.235 41.0 32.0 41.0 12.0 41.0 26 37.64675 41.0 37.0 41.0 27.0 41.0 27 34.95475 41.0 32.0 41.0 12.0 41.0 28 30.678 37.0 22.0 41.0 12.0 41.0 29 38.34875 41.0 37.0 41.0 32.0 41.0 30 33.92425 37.0 32.0 41.0 12.0 41.0 31 39.1185 41.0 41.0 41.0 37.0 41.0 32 28.1165 32.0 12.0 41.0 12.0 41.0 33 33.50925 37.0 27.0 41.0 12.0 41.0 34 31.23225 37.0 22.0 41.0 12.0 41.0 35 36.0705 41.0 37.0 41.0 22.0 41.0 36 24.48925 22.0 12.0 37.0 12.0 41.0 37 37.719 41.0 37.0 41.0 32.0 41.0 38 39.0635 41.0 41.0 41.0 37.0 41.0 39 33.371 37.0 27.0 41.0 12.0 41.0 40 38.544 41.0 37.0 41.0 32.0 41.0 41 27.5865 32.0 12.0 41.0 12.0 41.0 42 37.84025 41.0 37.0 41.0 32.0 41.0 43 39.86425 41.0 41.0 41.0 37.0 41.0 44 39.05075 41.0 41.0 41.0 37.0 41.0 45 34.334 41.0 32.0 41.0 12.0 41.0 46 38.67375 41.0 37.0 41.0 32.0 41.0 47 39.63175 41.0 41.0 41.0 37.0 41.0 48 39.485 41.0 41.0 41.0 37.0 41.0 49 39.70225 41.0 41.0 41.0 37.0 41.0 50 38.62275 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 2.0 25 3.0 26 9.0 27 19.0 28 29.0 29 47.0 30 87.0 31 120.0 32 126.0 33 217.0 34 268.0 35 397.0 36 515.0 37 717.0 38 732.0 39 609.0 40 99.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.5 8.575000000000001 7.124999999999999 38.800000000000004 2 28.44152563778732 8.916393028542561 36.29704470825966 26.345036625410458 3 25.575 13.475000000000001 22.2 38.75 4 27.35 23.400000000000002 20.825 28.425 5 28.325 26.0 23.150000000000002 22.525000000000002 6 24.25 30.825000000000003 23.674999999999997 21.25 7 22.75 21.45 38.574999999999996 17.224999999999998 8 21.15 22.025 31.4 25.424999999999997 9 20.599999999999998 19.75 35.199999999999996 24.45 10 22.5 34.4 25.8 17.299999999999997 11 24.975 25.7 24.099999999999998 25.224999999999998 12 24.425 21.325 27.275 26.974999999999998 13 24.175 24.325 27.0 24.5 14 24.125 24.3 26.400000000000002 25.174999999999997 15 23.724999999999998 25.3 26.25 24.725 16 25.6 25.25 23.474999999999998 25.674999999999997 17 23.425 23.599999999999998 26.875 26.1 18 23.200000000000003 24.4 25.45 26.950000000000003 19 23.7 24.775 25.15 26.375 20 25.974999999999998 24.025 24.875 25.124999999999996 21 23.799999999999997 24.325 26.275 25.6 22 23.75 24.9 24.325 27.025 23 23.775 25.374999999999996 26.525 24.325 24 22.900000000000002 25.4 26.224999999999998 25.474999999999998 25 29.75 25.0 21.6 23.65 26 23.025000000000002 24.95 26.275 25.75 27 24.85 24.55 26.55 24.05 28 27.975 24.2 24.925 22.900000000000002 29 24.15 25.474999999999998 25.174999999999997 25.2 30 24.575 23.225 25.45 26.75 31 22.05 25.174999999999997 26.200000000000003 26.575 32 29.575000000000003 22.225 25.775 22.425 33 24.2 23.825 25.624999999999996 26.35 34 25.25 24.3 26.25 24.2 35 22.6 25.15 25.8 26.450000000000003 36 28.975 24.625 24.875 21.525 37 24.2 25.25 25.1 25.45 38 23.849999999999998 25.1 25.525 25.525 39 25.900000000000002 24.575 24.625 24.9 40 24.675 24.125 25.7 25.5 41 30.2 22.125 24.875 22.8 42 23.875 25.05 24.175 26.900000000000002 43 24.474999999999998 24.55 25.75 25.224999999999998 44 22.825 25.124999999999996 26.125 25.924999999999997 45 25.775 24.125 24.275 25.825 46 24.275 24.65 24.75 26.325 47 21.975 25.900000000000002 26.55 25.575 48 23.275000000000002 24.05 26.25 26.424999999999997 49 23.9 25.124999999999996 24.75 26.224999999999998 50 24.18104526131533 23.730932733183295 27.106776694173547 24.981245311327832 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 4.5 26 5.0 27 6.5 28 8.0 29 18.0 30 28.0 31 35.0 32 42.0 33 54.0 34 66.0 35 83.0 36 100.0 37 124.5 38 149.0 39 180.5 40 212.0 41 232.0 42 252.0 43 282.5 44 313.0 45 316.5 46 320.0 47 343.0 48 366.0 49 354.5 50 343.0 51 323.5 52 304.0 53 281.5 54 259.0 55 249.0 56 239.0 57 221.5 58 204.0 59 194.5 60 185.0 61 166.5 62 148.0 63 140.5 64 133.0 65 112.5 66 92.0 67 81.0 68 70.0 69 63.5 70 57.0 71 51.0 72 45.0 73 30.0 74 15.0 75 16.0 76 17.0 77 15.0 78 13.0 79 7.5 80 2.0 81 2.0 82 2.0 83 1.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11320754716981 96.2 2 1.7848036715961242 3.5000000000000004 3 0.10198878123406425 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640938 READS because READLEN < 1 Read 1640938 spots for SRR6322349.sra Written 1640938 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Written 1640931 spots for SRR6322349.sra Rejected 1640931 READS because READLEN < 1 Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra Read 1640931 spots for SRR6322349.sra Written 1640931 spots for SRR6322349.sra SRR ids: ['SRR6322349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_co66kaz2 SRR6322349.sra spots: 32818627 blocks: [[1, 1640931], [1640932, 3281862], [3281863, 4922793], [4922794, 6563724], [6563725, 8204655], [8204656, 9845586], [9845587, 11486517], [11486518, 13127448], [13127449, 14768379], [14768380, 16409310], [16409311, 18050241], [18050242, 19691172], [19691173, 21332103], [21332104, 22973034], [22973035, 24613965], [24613966, 26254896], [26254897, 27895827], [27895828, 29536758], [29536759, 31177689], [31177690, 32818627]] SRR6322349 file size 4593419 SRR6322349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322349 SRR6322349_1.fastq Input file: SRR6322349_1.fastq trimmed: SRR6322349-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:40:22 2024 >> started Sat Dec 7 11:40:44 2024 >> done (21.474s) 32818627 reads processed; of these: 706 ( 0.00%) short reads filtered out after trimming by size control 26951 ( 0.08%) empty reads filtered out after trimming by size control 32790970 (99.92%) reads available; of these: 90 ( 0.00%) trimmed reads available after processing 32790880 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 67 0.00% 50 32790880 100.00% 32790970 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=7.33 fanout-score-rank=11 prefix-density=0.11 prefix-fanout=5.2 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAGCAAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=117.54 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.9 sequence=TCTTCTTCTTCCT Started job on | Dec 07 11:40:57 Started mapping on | Dec 07 11:40:57 Finished on | Dec 07 11:41:24 Mapping speed, Million of reads per hour | 4372.13 Number of input reads | 32790970 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 31222469 Uniquely mapped reads % | 95.22% Average mapped length | 49.84 Number of splices: Total | 4885827 Number of splices: Annotated (sjdb) | 4742426 Number of splices: GT/AG | 4826416 Number of splices: GC/AG | 51231 Number of splices: AT/AC | 3203 Number of splices: Non-canonical | 4977 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1145531 % of reads mapped to multiple loci | 3.49% Number of reads mapped to too many loci | 146366 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 422970 422970 422970 N_multimapping 1145531 1145531 1145531 N_noFeature 1216073 30639208 1381571 N_ambiguous 447106 2491 29635 UnstrandedReadsAssigned:29559290 PositiveStrandReadsAssigned:580770 NegativeStrandReadsAssigned:29811263 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322349 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322349-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,790,970 reads, 29,575,898 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,252 rounds 52973 SRR6322349.ke.tsv 35125 SRR6322349.se.tsv 88098 total ==> SRR6322349.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 215.114 15.2977 PNS24247 1044 945 71.0503 4.47522 PNS24249 1928 1829 48.6041 1.58176 PNS24246 1044 945 71.0503 4.47522 PNS24248 1044 945 71.0503 4.47522 PNS24244 1471 1372 216.131 9.37655 PNS24243 293 194 0 0 KQK14069 1603 1504 8.13353 0.321893 KQK14071 474 375 6.68805 1.06157 ==> SRR6322349.se.tsv <== BRADI_1g14170v3 26 BRADI_1g53295v3 17 BRADI_1g59795v3 592 BRADI_1g07683v3 0 BRADI_1g00485v3 358 BRADI_1g20270v3 5238 BRADI_1g74790v3 4 BRADI_1g09890v3 1 BRADI_1g77505v3 387 BRADI_1g48960v3 1 SRR6322349 completed mapping pipeline successfully