Starting /dee2/code/volunteer_pipeline.sh SRR6322350 current disk space = 1516012490752 free memory = 1601313920 SRR6322350 SRAfilesize 0bda839f4fda05454a37717e680ebf25 SRR6322350.sra SRR6322350.sra file validated SRR6322350 is single end SRR6322350 is conventional basespace SRR6322350 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322350_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.825 32.0 32.0 32.0 32.0 32.0 2 31.5275 32.0 32.0 32.0 32.0 32.0 3 35.86375 37.0 37.0 37.0 32.0 37.0 4 36.44375 37.0 37.0 37.0 37.0 37.0 5 36.73875 37.0 37.0 37.0 37.0 37.0 6 40.3665 41.0 41.0 41.0 41.0 41.0 7 40.28725 41.0 41.0 41.0 41.0 41.0 8 33.825 37.0 32.0 41.0 12.0 41.0 9 37.3245 41.0 37.0 41.0 32.0 41.0 10 34.9825 37.0 32.0 41.0 22.0 41.0 11 39.90975 41.0 41.0 41.0 37.0 41.0 12 38.7875 41.0 41.0 41.0 32.0 41.0 13 36.08825 41.0 37.0 41.0 22.0 41.0 14 35.91225 41.0 32.0 41.0 22.0 41.0 15 39.499 41.0 41.0 41.0 37.0 41.0 16 35.935 41.0 32.0 41.0 22.0 41.0 17 40.08575 41.0 41.0 41.0 37.0 41.0 18 40.42225 41.0 41.0 41.0 41.0 41.0 19 36.79225 41.0 37.0 41.0 27.0 41.0 20 39.453 41.0 41.0 41.0 37.0 41.0 21 39.2605 41.0 41.0 41.0 37.0 41.0 22 36.85075 41.0 37.0 41.0 27.0 41.0 23 39.51425 41.0 41.0 41.0 37.0 41.0 24 40.4125 41.0 41.0 41.0 41.0 41.0 25 35.14 41.0 32.0 41.0 22.0 41.0 26 39.32675 41.0 41.0 41.0 37.0 41.0 27 30.86875 37.0 22.0 41.0 12.0 41.0 28 36.80175 41.0 37.0 41.0 27.0 41.0 29 39.14975 41.0 41.0 41.0 37.0 41.0 30 39.83075 41.0 41.0 41.0 37.0 41.0 31 34.07125 41.0 32.0 41.0 12.0 41.0 32 32.29675 37.0 27.0 41.0 12.0 41.0 33 30.74875 37.0 22.0 41.0 12.0 41.0 34 33.59075 37.0 27.0 41.0 12.0 41.0 35 37.92525 41.0 37.0 41.0 32.0 41.0 36 26.5605 27.0 12.0 41.0 12.0 41.0 37 29.924 37.0 22.0 41.0 12.0 41.0 38 23.43425 22.0 12.0 37.0 12.0 41.0 39 23.839 22.0 12.0 37.0 12.0 37.0 40 32.99625 37.0 27.0 41.0 22.0 41.0 41 38.28325 41.0 37.0 41.0 32.0 41.0 42 33.81175 37.0 27.0 41.0 12.0 41.0 43 25.76375 27.0 12.0 37.0 12.0 41.0 44 24.731 22.0 12.0 37.0 12.0 41.0 45 21.9225 22.0 12.0 32.0 12.0 37.0 46 28.8735 32.0 22.0 37.0 12.0 41.0 47 24.752 27.0 12.0 37.0 12.0 41.0 48 36.441 37.0 37.0 41.0 27.0 41.0 49 38.634 41.0 37.0 41.0 32.0 41.0 50 39.9125 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 4.0 24 10.0 25 15.0 26 26.0 27 47.0 28 49.0 29 114.0 30 139.0 31 223.0 32 314.0 33 406.0 34 537.0 35 606.0 36 613.0 37 479.0 38 304.0 39 98.0 40 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.175 8.325000000000001 6.9750000000000005 43.525000000000006 2 23.92883988975194 10.724129290904536 36.10623903783513 29.240791781508396 3 23.9 13.4 22.925 39.775 4 27.325 20.3 20.95 31.424999999999997 5 29.15 25.124999999999996 23.200000000000003 22.525000000000002 6 24.05 29.275000000000002 24.725 21.95 7 16.950000000000003 25.974999999999998 40.0 17.075000000000003 8 25.074999999999996 23.7 28.625 22.6 9 19.05 21.975 35.275 23.7 10 22.675 33.7 25.025 18.6 11 25.424999999999997 26.650000000000002 22.8 25.124999999999996 12 23.325000000000003 23.150000000000002 26.474999999999998 27.05 13 24.725 27.0 25.95 22.325 14 24.175 25.174999999999997 26.075 24.575 15 23.200000000000003 24.9 26.275 25.624999999999996 16 25.825 25.4 23.25 25.525 17 23.325000000000003 24.375 26.150000000000002 26.150000000000002 18 22.375 25.724999999999998 26.825 25.074999999999996 19 26.1 24.9 23.35 25.650000000000002 20 22.025 27.125 26.125 24.725 21 24.3 26.075 24.474999999999998 25.15 22 23.625 26.625 24.325 25.424999999999997 23 22.625 26.625 26.025 24.725 24 21.2 25.6 26.150000000000002 27.05 25 25.974999999999998 24.175 24.7 25.15 26 21.6 26.25 25.85 26.3 27 26.174999999999997 24.075 24.075 25.674999999999997 28 22.900000000000002 27.3 24.45 25.35 29 22.15 26.700000000000003 26.575 24.575 30 22.05 24.85 26.775 26.325 31 24.325 25.900000000000002 24.175 25.6 32 24.775 26.275 24.85 24.099999999999998 33 25.55 23.799999999999997 25.6 25.05 34 23.674999999999997 25.275 25.575 25.474999999999998 35 23.724999999999998 25.0 27.200000000000003 24.075 36 28.125 24.15 26.450000000000003 21.275 37 27.075 24.8 23.849999999999998 24.275 38 27.975 24.7 26.924999999999997 20.4 39 28.199999999999996 24.425 23.225 24.15 40 24.05 26.325 24.375 25.25 41 22.8 25.45 28.025 23.724999999999998 42 23.674999999999997 24.25 25.074999999999996 27.0 43 28.249999999999996 24.0 25.7 22.05 44 28.65 24.15 24.725 22.475 45 27.3 23.7 26.150000000000002 22.85 46 25.474999999999998 25.2 25.174999999999997 24.15 47 26.900000000000002 26.8 24.75 21.55 48 22.7 24.9 27.075 25.324999999999996 49 24.349999999999998 24.9 24.8 25.95 50 22.525000000000002 24.575 26.974999999999998 25.924999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 1.0 24 0.0 25 3.0 26 6.0 27 10.5 28 15.0 29 15.0 30 15.0 31 25.0 32 35.0 33 51.5 34 68.0 35 90.5 36 113.0 37 125.5 38 138.0 39 172.5 40 207.0 41 243.0 42 279.0 43 309.5 44 340.0 45 331.5 46 323.0 47 338.0 48 353.0 49 369.5 50 386.0 51 379.0 52 372.0 53 335.0 54 298.0 55 265.5 56 233.0 57 220.0 58 207.0 59 186.0 60 165.0 61 139.0 62 113.0 63 105.5 64 98.0 65 89.5 66 81.0 67 67.5 68 54.0 69 48.0 70 42.0 71 34.0 72 26.0 73 21.5 74 17.0 75 11.0 76 5.0 77 4.5 78 4.0 79 2.5 80 1.0 81 0.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16582406471183 98.075 2 0.7583417593528816 1.5 3 0.02527805864509606 0.075 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 10 0.25 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088446 READS because READLEN < 1 Read 1088446 spots for SRR6322350.sra Written 1088446 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra Rejected 1088440 READS because READLEN < 1 Read 1088440 spots for SRR6322350.sra Written 1088440 spots for SRR6322350.sra SRR ids: ['SRR6322350.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y5b5w7ff SRR6322350.sra spots: 21768806 blocks: [[1, 1088440], [1088441, 2176880], [2176881, 3265320], [3265321, 4353760], [4353761, 5442200], [5442201, 6530640], [6530641, 7619080], [7619081, 8707520], [8707521, 9795960], [9795961, 10884400], [10884401, 11972840], [11972841, 13061280], [13061281, 14149720], [14149721, 15238160], [15238161, 16326600], [16326601, 17415040], [17415041, 18503480], [18503481, 19591920], [19591921, 20680360], [20680361, 21768806]] SRR6322350 file size 3039537 SRR6322350 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322350 SRR6322350_1.fastq Input file: SRR6322350_1.fastq trimmed: SRR6322350-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Dec 12 02:23:33 2024 >> started Thu Dec 12 02:23:45 2024 >> done (12.529s) 21768806 reads processed; of these: 407 ( 0.00%) short reads filtered out after trimming by size control 164259 ( 0.75%) empty reads filtered out after trimming by size control 21604140 (99.24%) reads available; of these: 1495 ( 0.01%) trimmed reads available after processing 21602645 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1479 0.01% 50 21602645 99.99% 21604140 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=7.36 fanout-score-rank=15 prefix-density=0.10 prefix-fanout=5.0 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAGCAAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=115.78 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.2 sequence=TCTTCTTCTTCCT Started job on | Dec 12 02:23:59 Started mapping on | Dec 12 02:23:59 Finished on | Dec 12 02:24:17 Mapping speed, Million of reads per hour | 4320.83 Number of input reads | 21604140 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20523527 Uniquely mapped reads % | 95.00% Average mapped length | 49.85 Number of splices: Total | 3310241 Number of splices: Annotated (sjdb) | 3218273 Number of splices: GT/AG | 3270716 Number of splices: GC/AG | 34545 Number of splices: AT/AC | 2097 Number of splices: Non-canonical | 2883 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 720066 % of reads mapped to multiple loci | 3.33% Number of reads mapped to too many loci | 64802 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 360547 360547 360547 N_multimapping 720066 720066 720066 N_noFeature 762841 20154769 859530 N_ambiguous 291138 1703 19346 UnstrandedReadsAssigned:19469548 PositiveStrandReadsAssigned:367055 NegativeStrandReadsAssigned:19644651 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322350 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322350-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,604,140 reads, 19,699,183 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 SRR6322350.ke.tsv 35125 SRR6322350.se.tsv 88098 total ==> SRR6322350.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 134.744 14.8621 PNS24247 1044 945 50.9453 4.97701 PNS24249 1928 1829 11.535 0.58224 PNS24246 1044 945 50.9453 4.97701 PNS24248 1044 945 50.9453 4.97701 PNS24244 1471 1372 146.885 9.88374 PNS24243 293 194 0 0 KQK14069 1603 1504 5.32861 0.327086 KQK14071 474 375 2.67139 0.657662 ==> SRR6322350.se.tsv <== BRADI_1g14170v3 9 BRADI_1g53295v3 13 BRADI_1g59795v3 356 BRADI_1g07683v3 0 BRADI_1g00485v3 305 BRADI_1g20270v3 4065 BRADI_1g74790v3 1 BRADI_1g09890v3 0 BRADI_1g77505v3 234 BRADI_1g48960v3 1 SRR6322350 completed mapping pipeline successfully