Starting /dee2/code/volunteer_pipeline.sh SRR6322351 current disk space = 1544115179520 free memory = 1605660376 SRR6322351 SRAfilesize e832748bb81bb1827966c4dd330da2d8 SRR6322351.sra SRR6322351.sra file validated SRR6322351 is single end SRR6322351 is conventional basespace SRR6322351 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322351_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.68625 32.0 32.0 32.0 32.0 32.0 2 25.6275 32.0 12.0 32.0 12.0 32.0 3 33.65125 32.0 32.0 37.0 32.0 37.0 4 35.49875 37.0 37.0 37.0 32.0 37.0 5 36.57625 37.0 37.0 37.0 37.0 37.0 6 39.99 41.0 41.0 41.0 37.0 41.0 7 32.143 37.0 27.0 41.0 12.0 41.0 8 38.708 41.0 37.0 41.0 32.0 41.0 9 38.80625 41.0 37.0 41.0 32.0 41.0 10 40.131 41.0 41.0 41.0 37.0 41.0 11 40.2715 41.0 41.0 41.0 41.0 41.0 12 40.09825 41.0 41.0 41.0 37.0 41.0 13 38.954 41.0 41.0 41.0 32.0 41.0 14 38.14775 41.0 37.0 41.0 32.0 41.0 15 39.39025 41.0 41.0 41.0 37.0 41.0 16 36.529 41.0 37.0 41.0 27.0 41.0 17 39.57425 41.0 41.0 41.0 37.0 41.0 18 40.3115 41.0 41.0 41.0 41.0 41.0 19 40.117 41.0 41.0 41.0 37.0 41.0 20 36.432 41.0 37.0 41.0 27.0 41.0 21 39.9995 41.0 41.0 41.0 37.0 41.0 22 40.1115 41.0 41.0 41.0 37.0 41.0 23 38.5105 41.0 37.0 41.0 32.0 41.0 24 39.99125 41.0 41.0 41.0 37.0 41.0 25 34.3205 41.0 32.0 41.0 12.0 41.0 26 37.79525 41.0 37.0 41.0 27.0 41.0 27 35.0345 41.0 32.0 41.0 12.0 41.0 28 30.62075 37.0 22.0 41.0 12.0 41.0 29 38.3415 41.0 37.0 41.0 32.0 41.0 30 34.0295 37.0 32.0 41.0 12.0 41.0 31 39.21425 41.0 41.0 41.0 37.0 41.0 32 28.257 32.0 12.0 41.0 12.0 41.0 33 33.62425 37.0 27.0 41.0 12.0 41.0 34 31.611 37.0 22.0 41.0 12.0 41.0 35 36.37075 41.0 37.0 41.0 27.0 41.0 36 24.79575 27.0 12.0 37.0 12.0 41.0 37 37.77925 41.0 37.0 41.0 32.0 41.0 38 38.95225 41.0 41.0 41.0 37.0 41.0 39 33.3735 37.0 27.0 41.0 12.0 41.0 40 38.5065 41.0 37.0 41.0 32.0 41.0 41 27.4665 27.0 12.0 41.0 12.0 41.0 42 37.7865 41.0 37.0 41.0 32.0 41.0 43 39.87 41.0 41.0 41.0 37.0 41.0 44 39.07 41.0 41.0 41.0 37.0 41.0 45 34.28275 41.0 32.0 41.0 12.0 41.0 46 38.8205 41.0 37.0 41.0 37.0 41.0 47 39.65425 41.0 41.0 41.0 37.0 41.0 48 39.33075 41.0 41.0 41.0 37.0 41.0 49 39.59925 41.0 41.0 41.0 37.0 41.0 50 38.689 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 6.0 26 12.0 27 23.0 28 35.0 29 57.0 30 81.0 31 106.0 32 123.0 33 192.0 34 295.0 35 344.0 36 511.0 37 736.0 38 806.0 39 595.0 40 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.15 9.75 6.7250000000000005 35.375 2 28.077699293642784 9.863773965691221 34.233097880928355 27.825428859737638 3 23.849999999999998 18.825 24.8 32.525 4 29.2 24.875 20.775 25.15 5 26.650000000000002 28.549999999999997 22.975 21.825 6 23.925 31.0 23.7 21.375 7 22.225 23.25 38.074999999999996 16.45 8 20.424999999999997 22.475 30.7 26.400000000000002 9 20.474999999999998 20.225 34.35 24.95 10 22.35 34.775 25.525 17.349999999999998 11 26.875 24.675 21.55 26.900000000000002 12 24.65 23.5 25.374999999999996 26.474999999999998 13 22.0 25.15 27.474999999999998 25.374999999999996 14 22.875 26.400000000000002 26.575 24.15 15 23.400000000000002 26.150000000000002 25.025 25.424999999999997 16 25.575 25.45 24.3 24.675 17 24.575 25.15 25.75 24.525 18 21.45 26.224999999999998 26.3 26.025 19 24.075 25.5 24.375 26.05 20 25.25 25.15 25.05 24.55 21 22.95 25.75 25.15 26.150000000000002 22 25.074999999999996 26.375 24.275 24.275 23 24.55 25.974999999999998 24.6 24.875 24 22.175 25.025 25.85 26.950000000000003 25 28.725 24.725 21.6 24.95 26 22.475 25.85 25.45 26.224999999999998 27 23.175 25.424999999999997 24.474999999999998 26.924999999999997 28 29.2 24.675 22.8 23.325000000000003 29 24.2 25.924999999999997 25.874999999999996 24.0 30 25.324999999999996 23.65 25.2 25.825 31 22.825 25.4 25.15 26.625 32 29.725 24.375 23.799999999999997 22.1 33 24.15 25.674999999999997 25.0 25.174999999999997 34 25.05 27.525 24.15 23.275000000000002 35 22.475 26.400000000000002 25.124999999999996 26.0 36 28.975 25.775 23.1 22.15 37 24.75 25.974999999999998 24.95 24.325 38 23.625 25.5 24.9 25.974999999999998 39 26.025 25.0 25.025 23.95 40 24.3 25.575 24.575 25.55 41 29.275000000000002 24.7 24.3 21.725 42 22.575 24.2 26.150000000000002 27.075 43 23.3 25.85 24.425 26.424999999999997 44 23.125 25.074999999999996 25.15 26.650000000000002 45 25.25 24.6 24.45 25.7 46 24.975 24.625 25.974999999999998 24.425 47 23.775 26.1 25.025 25.1 48 23.0 26.55 24.375 26.075 49 24.725 25.5 24.224999999999998 25.55 50 23.549999999999997 25.825 24.775 25.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 5.0 26 8.0 27 12.0 28 16.0 29 27.0 30 38.0 31 38.5 32 39.0 33 51.5 34 64.0 35 87.5 36 111.0 37 140.0 38 169.0 39 189.5 40 210.0 41 216.0 42 222.0 43 269.0 44 316.0 45 309.5 46 303.0 47 320.5 48 338.0 49 338.5 50 339.0 51 354.5 52 370.0 53 335.0 54 300.0 55 288.0 56 276.0 57 246.5 58 217.0 59 196.0 60 175.0 61 151.0 62 127.0 63 116.5 64 106.0 65 88.5 66 71.0 67 65.0 68 59.0 69 49.5 70 40.0 71 35.0 72 30.0 73 24.5 74 19.0 75 17.0 76 15.0 77 10.5 78 6.0 79 6.5 80 7.0 81 3.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.05924412665986 96.0 2 1.7364657814096014 3.4000000000000004 3 0.20429009193054137 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra Rejected 1387510 READS because READLEN < 1 Read 1387510 spots for SRR6322351.sra Written 1387510 spots for SRR6322351.sra Rejected 1387492 READS because READLEN < 1 Read 1387492 spots for SRR6322351.sra Written 1387492 spots for SRR6322351.sra SRR ids: ['SRR6322351.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1oojfvka SRR6322351.sra spots: 27749858 blocks: [[1, 1387492], [1387493, 2774984], [2774985, 4162476], [4162477, 5549968], [5549969, 6937460], [6937461, 8324952], [8324953, 9712444], [9712445, 11099936], [11099937, 12487428], [12487429, 13874920], [13874921, 15262412], [15262413, 16649904], [16649905, 18037396], [18037397, 19424888], [19424889, 20812380], [20812381, 22199872], [22199873, 23587364], [23587365, 24974856], [24974857, 26362348], [26362349, 27749858]] SRR6322351 file size 3880623 SRR6322351 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322351 SRR6322351_1.fastq Input file: SRR6322351_1.fastq trimmed: SRR6322351-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:41:48 2024 >> started Sat Dec 7 09:42:04 2024 >> done (16.524s) 27749858 reads processed; of these: 252 ( 0.00%) short reads filtered out after trimming by size control 65925 ( 0.24%) empty reads filtered out after trimming by size control 27683681 (99.76%) reads available; of these: 63 ( 0.00%) trimmed reads available after processing 27683618 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 52 0.00% 50 27683618 100.00% 27683681 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=21 prefix-density=0.08 prefix-fanout=2.0 sequence=AACCATGTTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=13.75 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.8 sequence=ATGGTGATCACATCGGCATCCATGTTAATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGGACACCACAGTTGGTGATCCTGAAGGAGT Started job on | Dec 07 09:42:15 Started mapping on | Dec 07 09:42:15 Finished on | Dec 07 09:42:41 Mapping speed, Million of reads per hour | 3833.13 Number of input reads | 27683681 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 24762657 Uniquely mapped reads % | 89.45% Average mapped length | 49.84 Number of splices: Total | 3502517 Number of splices: Annotated (sjdb) | 3403518 Number of splices: GT/AG | 3462014 Number of splices: GC/AG | 34537 Number of splices: AT/AC | 2069 Number of splices: Non-canonical | 3897 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 914242 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 1507585 % of reads mapped to too many loci | 5.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2006782 2006782 2006782 N_multimapping 914242 914242 914242 N_noFeature 1006073 24270384 1132929 N_ambiguous 388203 1805 23212 UnstrandedReadsAssigned:23368381 PositiveStrandReadsAssigned:490468 NegativeStrandReadsAssigned:23606516 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322351 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322351-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,683,681 reads, 23,255,772 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,384 rounds 52973 SRR6322351.ke.tsv 35125 SRR6322351.se.tsv 88098 total ==> SRR6322351.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 111.928 10.6381 PNS24247 1044 945 40.3538 3.39706 PNS24249 1928 1829 23.4104 1.01823 PNS24246 1044 945 40.3538 3.39706 PNS24248 1044 945 40.3538 3.39706 PNS24244 1471 1372 116.6 6.76076 PNS24243 293 194 0 0 KQK14069 1603 1504 8.62426 0.456168 KQK14071 474 375 1.54241 0.327204 ==> SRR6322351.se.tsv <== BRADI_1g14170v3 25 BRADI_1g53295v3 27 BRADI_1g59795v3 363 BRADI_1g07683v3 0 BRADI_1g00485v3 932 BRADI_1g20270v3 6866 BRADI_1g74790v3 4 BRADI_1g09890v3 0 BRADI_1g77505v3 131 BRADI_1g48960v3 0 SRR6322351 completed mapping pipeline successfully