Starting /dee2/code/volunteer_pipeline.sh SRR6322352 current disk space = 1542937837568 free memory = 1594340532 SRR6322352 SRAfilesize 17b35f5fd0a5b83bb2f6f1cd7ed03529 SRR6322352.sra SRR6322352.sra file validated SRR6322352 is single end SRR6322352 is conventional basespace SRR6322352 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8525 32.0 32.0 32.0 32.0 32.0 2 31.50125 32.0 32.0 32.0 32.0 32.0 3 35.77 37.0 37.0 37.0 32.0 37.0 4 36.35625 37.0 37.0 37.0 37.0 37.0 5 36.74625 37.0 37.0 37.0 37.0 37.0 6 40.381 41.0 41.0 41.0 41.0 41.0 7 40.2645 41.0 41.0 41.0 37.0 41.0 8 33.45 37.0 32.0 41.0 12.0 41.0 9 37.3375 41.0 37.0 41.0 32.0 41.0 10 35.07725 41.0 32.0 41.0 22.0 41.0 11 39.87625 41.0 41.0 41.0 37.0 41.0 12 38.57975 41.0 37.0 41.0 32.0 41.0 13 36.23775 41.0 37.0 41.0 22.0 41.0 14 36.01975 41.0 32.0 41.0 22.0 41.0 15 39.57425 41.0 41.0 41.0 37.0 41.0 16 35.8855 41.0 32.0 41.0 22.0 41.0 17 39.98525 41.0 41.0 41.0 37.0 41.0 18 40.35875 41.0 41.0 41.0 41.0 41.0 19 36.559 41.0 37.0 41.0 27.0 41.0 20 39.17 41.0 41.0 41.0 37.0 41.0 21 39.23925 41.0 41.0 41.0 37.0 41.0 22 37.0025 41.0 37.0 41.0 27.0 41.0 23 39.42875 41.0 41.0 41.0 37.0 41.0 24 40.37175 41.0 41.0 41.0 41.0 41.0 25 35.12575 41.0 32.0 41.0 22.0 41.0 26 39.26425 41.0 41.0 41.0 37.0 41.0 27 30.69125 37.0 22.0 41.0 12.0 41.0 28 36.90925 41.0 37.0 41.0 27.0 41.0 29 39.0775 41.0 41.0 41.0 37.0 41.0 30 39.77025 41.0 41.0 41.0 37.0 41.0 31 34.0045 41.0 32.0 41.0 12.0 41.0 32 32.13275 37.0 27.0 41.0 12.0 41.0 33 31.087 37.0 22.0 41.0 12.0 41.0 34 33.615 37.0 27.0 41.0 12.0 41.0 35 37.87325 41.0 37.0 41.0 27.0 41.0 36 26.704 27.0 12.0 41.0 12.0 41.0 37 29.81175 32.0 22.0 41.0 12.0 41.0 38 23.065 22.0 12.0 37.0 12.0 41.0 39 24.03275 22.0 12.0 37.0 12.0 41.0 40 32.75075 37.0 27.0 41.0 22.0 41.0 41 38.24625 41.0 37.0 41.0 32.0 41.0 42 33.956 37.0 32.0 41.0 12.0 41.0 43 25.48075 27.0 12.0 37.0 12.0 41.0 44 24.757 27.0 12.0 37.0 12.0 41.0 45 21.9565 22.0 12.0 32.0 12.0 37.0 46 28.905 32.0 22.0 37.0 12.0 41.0 47 24.85575 27.0 12.0 37.0 12.0 41.0 48 36.2425 37.0 37.0 41.0 27.0 41.0 49 38.481 41.0 37.0 41.0 32.0 41.0 50 39.7985 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 5.0 24 9.0 25 13.0 26 29.0 27 50.0 28 74.0 29 96.0 30 143.0 31 222.0 32 313.0 33 410.0 34 548.0 35 619.0 36 582.0 37 503.0 38 271.0 39 100.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.675 8.1 6.0249999999999995 41.199999999999996 2 23.84056154424668 10.930057658561044 35.42241163198796 29.80696916520431 3 23.5 15.0 23.1 38.4 4 29.775000000000002 21.175 20.65 28.4 5 29.775000000000002 25.55 22.650000000000002 22.025 6 24.175 29.975 23.7 22.15 7 18.65 25.424999999999997 38.05 17.875 8 24.075 23.575 28.275 24.075 9 20.05 23.025000000000002 31.8 25.124999999999996 10 23.724999999999998 33.425 24.2 18.65 11 25.650000000000002 25.5 22.825 26.025 12 23.325000000000003 22.95 27.250000000000004 26.474999999999998 13 25.074999999999996 24.375 26.75 23.799999999999997 14 24.224999999999998 26.0 25.174999999999997 24.6 15 22.95 25.275 26.8 24.975 16 26.724999999999998 24.7 22.875 25.7 17 23.474999999999998 25.4 25.324999999999996 25.8 18 22.575 26.05 24.55 26.825 19 24.95 25.8 22.875 26.375 20 21.75 26.25 27.1 24.9 21 23.9 26.1 24.05 25.95 22 25.374999999999996 25.5 23.599999999999998 25.525 23 23.65 25.25 25.5 25.6 24 22.650000000000002 24.45 25.474999999999998 27.425 25 27.775 24.75 21.525 25.95 26 22.175 26.5 24.275 27.05 27 27.825 24.675 23.275000000000002 24.224999999999998 28 24.175 26.275 23.45 26.1 29 23.425 24.525 26.474999999999998 25.575 30 23.05 26.3 24.575 26.075 31 27.6 25.025 22.675 24.7 32 26.375 26.55 23.05 24.025 33 26.8 24.099999999999998 25.074999999999996 24.025 34 25.224999999999998 25.95 23.799999999999997 25.025 35 23.674999999999997 25.924999999999997 25.2 25.2 36 27.950000000000003 24.474999999999998 26.85 20.724999999999998 37 27.775 24.6 24.15 23.474999999999998 38 28.075 24.15 26.450000000000003 21.325 39 27.925 24.075 23.95 24.05 40 23.775 25.674999999999997 24.2 26.35 41 23.0 24.95 25.7 26.35 42 24.95 24.675 23.775 26.6 43 28.299999999999997 21.95 26.25 23.5 44 29.2 23.825 24.325 22.650000000000002 45 27.075 24.95 26.6 21.375 46 28.000000000000004 23.875 23.375 24.75 47 27.625 25.35 25.424999999999997 21.6 48 23.9 25.474999999999998 25.95 24.675 49 24.275 24.65 25.3 25.775 50 22.125 25.85 26.200000000000003 25.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 2.0 3 1.0 4 0.0 5 1.0 6 2.0 7 1.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 1.0 24 0.0 25 2.5 26 5.0 27 5.0 28 5.0 29 12.0 30 19.0 31 25.5 32 32.0 33 44.0 34 56.0 35 78.0 36 100.0 37 122.0 38 144.0 39 176.0 40 208.0 41 215.5 42 223.0 43 270.5 44 318.0 45 318.0 46 318.0 47 327.5 48 337.0 49 347.0 50 357.0 51 350.5 52 344.0 53 323.0 54 302.0 55 280.5 56 259.0 57 243.5 58 228.0 59 207.5 60 187.0 61 158.0 62 129.0 63 126.0 64 123.0 65 111.0 66 99.0 67 81.0 68 63.0 69 58.0 70 53.0 71 44.0 72 35.0 73 30.5 74 26.0 75 19.5 76 13.0 77 7.5 78 2.0 79 3.0 80 4.0 81 2.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6294058408862034 1.25 3 0.0 0.0 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211701 READS because READLEN < 1 Read 1211701 spots for SRR6322352.sra Written 1211701 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra Rejected 1211688 READS because READLEN < 1 Read 1211688 spots for SRR6322352.sra Written 1211688 spots for SRR6322352.sra SRR ids: ['SRR6322352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ywqwinu SRR6322352.sra spots: 24233773 blocks: [[1, 1211688], [1211689, 2423376], [2423377, 3635064], [3635065, 4846752], [4846753, 6058440], [6058441, 7270128], [7270129, 8481816], [8481817, 9693504], [9693505, 10905192], [10905193, 12116880], [12116881, 13328568], [13328569, 14540256], [14540257, 15751944], [15751945, 16963632], [16963633, 18175320], [18175321, 19387008], [19387009, 20598696], [20598697, 21810384], [21810385, 23022072], [23022073, 24233773]] SRR6322352 file size 3386173 SRR6322352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322352 SRR6322352_1.fastq Input file: SRR6322352_1.fastq trimmed: SRR6322352-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:41:01 2024 >> started Sat Dec 7 11:41:22 2024 >> done (20.439s) 24233773 reads processed; of these: 469 ( 0.00%) short reads filtered out after trimming by size control 82416 ( 0.34%) empty reads filtered out after trimming by size control 24150888 (99.66%) reads available; of these: 1655 ( 0.01%) trimmed reads available after processing 24149233 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1640 0.01% 50 24149233 99.99% 24150888 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=14 prefix-density=0.09 prefix-fanout=3.5 sequence=CTCGTACTCGCCCTCCTCGTCAGCAGTAGCATCCTGATACTGCTGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=22.40 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.6 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGC Started job on | Dec 07 11:41:32 Started mapping on | Dec 07 11:41:33 Finished on | Dec 07 11:41:57 Mapping speed, Million of reads per hour | 3622.63 Number of input reads | 24150888 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 23179962 Uniquely mapped reads % | 95.98% Average mapped length | 49.85 Number of splices: Total | 3463569 Number of splices: Annotated (sjdb) | 3361671 Number of splices: GT/AG | 3425039 Number of splices: GC/AG | 33374 Number of splices: AT/AC | 2100 Number of splices: Non-canonical | 3056 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 605492 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 92055 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365434 365434 365434 N_multimapping 605492 605492 605492 N_noFeature 833069 22735087 938971 N_ambiguous 359567 1701 21247 UnstrandedReadsAssigned:21987326 PositiveStrandReadsAssigned:443174 NegativeStrandReadsAssigned:22219744 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322352 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322352-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,150,888 reads, 22,079,084 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6322352.ke.tsv 35125 SRR6322352.se.tsv 88098 total ==> SRR6322352.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 183.109 18.5698 PNS24247 1044 945 20.3619 1.82897 PNS24249 1928 1829 12.0066 0.55722 PNS24246 1044 945 20.3619 1.82897 PNS24248 1044 945 20.3619 1.82897 PNS24244 1471 1372 80.7986 4.99887 PNS24243 293 194 0 0 KQK14069 1603 1504 9.24681 0.521874 KQK14071 474 375 2.20468 0.49904 ==> SRR6322352.se.tsv <== BRADI_1g14170v3 24 BRADI_1g53295v3 27 BRADI_1g59795v3 335 BRADI_1g07683v3 0 BRADI_1g00485v3 1027 BRADI_1g20270v3 7288 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 111 BRADI_1g48960v3 0 SRR6322352 completed mapping pipeline successfully