Starting /dee2/code/volunteer_pipeline.sh SRR6322353 current disk space = 1542934032384 free memory = 1600242708 SRR6322353 SRAfilesize 61449fb566c87edfb3d15cd8b3e29b93 SRR6322353.sra SRR6322353.sra file validated SRR6322353 is single end SRR6322353 is conventional basespace SRR6322353 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322353_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65 32.0 32.0 32.0 32.0 32.0 2 25.98375 32.0 12.0 32.0 12.0 32.0 3 33.6525 32.0 32.0 37.0 32.0 37.0 4 35.54375 37.0 37.0 37.0 32.0 37.0 5 36.6425 37.0 37.0 37.0 37.0 37.0 6 40.1295 41.0 41.0 41.0 37.0 41.0 7 32.23775 37.0 27.0 41.0 12.0 41.0 8 38.8525 41.0 37.0 41.0 32.0 41.0 9 38.93175 41.0 37.0 41.0 32.0 41.0 10 40.21775 41.0 41.0 41.0 37.0 41.0 11 40.3495 41.0 41.0 41.0 41.0 41.0 12 40.1255 41.0 41.0 41.0 37.0 41.0 13 38.98425 41.0 41.0 41.0 32.0 41.0 14 38.19375 41.0 37.0 41.0 32.0 41.0 15 39.49375 41.0 41.0 41.0 37.0 41.0 16 36.476 41.0 37.0 41.0 27.0 41.0 17 39.66525 41.0 41.0 41.0 37.0 41.0 18 40.3705 41.0 41.0 41.0 41.0 41.0 19 40.1145 41.0 41.0 41.0 37.0 41.0 20 36.53775 41.0 37.0 41.0 27.0 41.0 21 39.9815 41.0 41.0 41.0 37.0 41.0 22 40.03725 41.0 41.0 41.0 37.0 41.0 23 38.50675 41.0 37.0 41.0 32.0 41.0 24 40.05825 41.0 41.0 41.0 37.0 41.0 25 34.26 37.0 32.0 41.0 12.0 41.0 26 37.35425 41.0 37.0 41.0 27.0 41.0 27 35.194 41.0 32.0 41.0 22.0 41.0 28 30.39025 37.0 22.0 41.0 12.0 41.0 29 38.297 41.0 37.0 41.0 32.0 41.0 30 34.15025 37.0 32.0 41.0 12.0 41.0 31 39.21925 41.0 41.0 41.0 37.0 41.0 32 28.07875 32.0 12.0 41.0 12.0 41.0 33 33.62175 37.0 27.0 41.0 12.0 41.0 34 31.774 37.0 27.0 41.0 12.0 41.0 35 36.339 41.0 37.0 41.0 22.0 41.0 36 24.56975 22.0 12.0 37.0 12.0 41.0 37 37.7085 41.0 37.0 41.0 32.0 41.0 38 39.06425 41.0 41.0 41.0 37.0 41.0 39 33.60125 41.0 27.0 41.0 12.0 41.0 40 38.63325 41.0 37.0 41.0 32.0 41.0 41 27.31025 27.0 12.0 41.0 12.0 41.0 42 37.98825 41.0 37.0 41.0 32.0 41.0 43 39.87325 41.0 41.0 41.0 37.0 41.0 44 38.9955 41.0 41.0 41.0 37.0 41.0 45 34.6765 41.0 32.0 41.0 12.0 41.0 46 38.8375 41.0 41.0 41.0 37.0 41.0 47 39.7155 41.0 41.0 41.0 37.0 41.0 48 39.53725 41.0 41.0 41.0 37.0 41.0 49 39.69 41.0 41.0 41.0 37.0 41.0 50 38.768 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 1.0 25 3.0 26 11.0 27 17.0 28 32.0 29 62.0 30 72.0 31 94.0 32 136.0 33 186.0 34 277.0 35 390.0 36 504.0 37 733.0 38 794.0 39 597.0 40 88.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.275 8.525 6.4750000000000005 39.725 2 28.769891386713812 8.739580702197525 33.922707754483454 28.567820156605205 3 25.924999999999997 14.35 21.55 38.175 4 29.45 19.45 20.1 31.0 5 28.7 25.724999999999998 22.6 22.975 6 26.125 28.025 23.775 22.075 7 22.85 22.925 37.45 16.775000000000002 8 21.975 23.025000000000002 29.075 25.924999999999997 9 21.099999999999998 21.6 33.1 24.2 10 22.15 34.475 25.525 17.849999999999998 11 26.6 24.7 23.075000000000003 25.624999999999996 12 24.725 21.775 27.625 25.874999999999996 13 24.099999999999998 26.200000000000003 25.424999999999997 24.275 14 24.9 25.025 25.1 24.975 15 23.875 26.400000000000002 24.7 25.025 16 25.374999999999996 25.85 24.05 24.725 17 25.374999999999996 24.349999999999998 25.6 24.675 18 24.25 24.4 24.975 26.375 19 24.25 25.074999999999996 25.474999999999998 25.2 20 24.825 25.474999999999998 23.95 25.75 21 25.2 25.900000000000002 24.099999999999998 24.8 22 25.775 25.124999999999996 24.925 24.175 23 25.275 25.900000000000002 23.65 25.174999999999997 24 22.15 24.725 26.325 26.8 25 28.999999999999996 24.15 21.625 25.224999999999998 26 24.05 25.2 25.275 25.474999999999998 27 25.775 25.124999999999996 23.25 25.85 28 29.275000000000002 23.400000000000002 23.275000000000002 24.05 29 23.925 25.374999999999996 25.224999999999998 25.474999999999998 30 26.1 25.15 24.275 24.474999999999998 31 23.974999999999998 25.05 25.1 25.874999999999996 32 29.45 23.7 23.525 23.325000000000003 33 23.9 24.175 25.4 26.525 34 27.85 24.825 23.150000000000002 24.175 35 25.124999999999996 25.374999999999996 25.15 24.349999999999998 36 29.4 25.0 23.05 22.55 37 24.5 25.55 24.7 25.25 38 25.374999999999996 25.224999999999998 24.525 24.875 39 25.95 24.4 23.5 26.150000000000002 40 24.05 25.7 24.775 25.474999999999998 41 31.15 23.075000000000003 24.5 21.275 42 25.5 26.1 22.825 25.575 43 23.95598899724931 25.55638909727432 25.03125781445361 25.456364091022753 44 24.05 24.474999999999998 25.75 25.724999999999998 45 26.25 23.849999999999998 24.5 25.4 46 24.425 25.575 24.675 25.324999999999996 47 24.925 23.95 26.375 24.75 48 24.15 25.85 24.575 25.424999999999997 49 24.775 26.0 24.575 24.65 50 25.131282820705174 23.830957739434858 24.781195298824706 26.25656414103526 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 5.0 26 8.0 27 8.0 28 8.0 29 15.0 30 22.0 31 34.5 32 47.0 33 51.5 34 56.0 35 84.5 36 113.0 37 118.5 38 124.0 39 157.5 40 191.0 41 214.0 42 237.0 43 274.0 44 311.0 45 315.5 46 320.0 47 313.0 48 306.0 49 324.0 50 342.0 51 319.5 52 297.0 53 285.0 54 273.0 55 269.0 56 265.0 57 238.0 58 211.0 59 197.5 60 184.0 61 187.5 62 191.0 63 160.0 64 129.0 65 117.0 66 105.0 67 92.0 68 79.0 69 68.5 70 58.0 71 58.0 72 58.0 73 43.0 74 28.0 75 20.0 76 12.0 77 12.5 78 13.0 79 9.5 80 6.0 81 3.5 82 1.0 83 1.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.71677783478707 95.22500000000001 2 2.052334530528476 4.0 3 0.17957927142124167 0.525 4 0.02565418163160595 0.1 5 0.0 0.0 6 0.02565418163160595 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 6 0.15 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200059 READS because READLEN < 1 Read 1200059 spots for SRR6322353.sra Written 1200059 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra Rejected 1200046 READS because READLEN < 1 Read 1200046 spots for SRR6322353.sra Written 1200046 spots for SRR6322353.sra SRR ids: ['SRR6322353.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0d4ndp6i SRR6322353.sra spots: 24000933 blocks: [[1, 1200046], [1200047, 2400092], [2400093, 3600138], [3600139, 4800184], [4800185, 6000230], [6000231, 7200276], [7200277, 8400322], [8400323, 9600368], [9600369, 10800414], [10800415, 12000460], [12000461, 13200506], [13200507, 14400552], [14400553, 15600598], [15600599, 16800644], [16800645, 18000690], [18000691, 19200736], [19200737, 20400782], [20400783, 21600828], [21600829, 22800874], [22800875, 24000933]] SRR6322353 file size 3353430 SRR6322353 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322353 SRR6322353_1.fastq Input file: SRR6322353_1.fastq trimmed: SRR6322353-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:40:53 2024 >> started Sat Dec 7 11:41:08 2024 >> done (14.712s) 24000933 reads processed; of these: 647 ( 0.00%) short reads filtered out after trimming by size control 87838 ( 0.37%) empty reads filtered out after trimming by size control 23912448 (99.63%) reads available; of these: 70 ( 0.00%) trimmed reads available after processing 23912378 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 49 0.00% 50 23912378 100.00% 23912448 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.70 fanout-score-rank=13 prefix-density=0.11 prefix-fanout=3.5 sequence=CTCGTACTCGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=13.66 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.4 sequence=CGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTCGTGCTTCTCGTAGAGGGCGAAGGCGCCAGCGGCGGCG Started job on | Dec 07 11:41:21 Started mapping on | Dec 07 11:41:21 Finished on | Dec 07 11:41:41 Mapping speed, Million of reads per hour | 4304.24 Number of input reads | 23912448 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 22922467 Uniquely mapped reads % | 95.86% Average mapped length | 49.84 Number of splices: Total | 3188870 Number of splices: Annotated (sjdb) | 3094810 Number of splices: GT/AG | 3153051 Number of splices: GC/AG | 30557 Number of splices: AT/AC | 1919 Number of splices: Non-canonical | 3343 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501907 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 90974 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 488074 488074 488074 N_multimapping 501907 501907 501907 N_noFeature 866661 22442072 991634 N_ambiguous 374432 1581 19673 UnstrandedReadsAssigned:21681374 PositiveStrandReadsAssigned:478814 NegativeStrandReadsAssigned:21911160 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322353 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322353-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,912,448 reads, 21,439,296 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR6322353.ke.tsv 35125 SRR6322353.se.tsv 88098 total ==> SRR6322353.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 129.288 13.4586 PNS24247 1044 945 22.6809 2.09119 PNS24249 1928 1829 16.0088 0.762621 PNS24246 1044 945 22.6809 2.09119 PNS24248 1044 945 22.6809 2.09119 PNS24244 1471 1372 111.66 7.09104 PNS24243 293 194 0 0 KQK14069 1603 1504 7.60179 0.440386 KQK14071 474 375 2.82677 0.656787 ==> SRR6322353.se.tsv <== BRADI_1g14170v3 14 BRADI_1g53295v3 15 BRADI_1g59795v3 265 BRADI_1g07683v3 0 BRADI_1g00485v3 981 BRADI_1g20270v3 5635 BRADI_1g74790v3 7 BRADI_1g09890v3 7 BRADI_1g77505v3 94 BRADI_1g48960v3 0 SRR6322353 completed mapping pipeline successfully