Starting /dee2/code/volunteer_pipeline.sh SRR6322354 current disk space = 1542929195008 free memory = 1598318076 SRR6322354 SRAfilesize 45783d8dc7fbc486136210b4bed3bb65 SRR6322354.sra SRR6322354.sra file validated SRR6322354 is single end SRR6322354 is conventional basespace SRR6322354 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8625 32.0 32.0 32.0 32.0 32.0 2 31.42875 32.0 32.0 32.0 32.0 32.0 3 35.54 37.0 37.0 37.0 32.0 37.0 4 36.265 37.0 37.0 37.0 37.0 37.0 5 36.7125 37.0 37.0 37.0 37.0 37.0 6 40.34825 41.0 41.0 41.0 37.0 41.0 7 40.103 41.0 41.0 41.0 37.0 41.0 8 33.24525 37.0 32.0 41.0 12.0 41.0 9 36.93725 41.0 37.0 41.0 32.0 41.0 10 34.303 37.0 32.0 41.0 12.0 41.0 11 39.75925 41.0 41.0 41.0 37.0 41.0 12 38.21875 41.0 37.0 41.0 32.0 41.0 13 35.503 41.0 32.0 41.0 22.0 41.0 14 35.0935 41.0 32.0 41.0 22.0 41.0 15 39.245 41.0 37.0 41.0 37.0 41.0 16 35.13725 41.0 32.0 41.0 22.0 41.0 17 39.91825 41.0 41.0 41.0 37.0 41.0 18 40.26 41.0 41.0 41.0 37.0 41.0 19 36.5475 41.0 37.0 41.0 27.0 41.0 20 39.1245 41.0 41.0 41.0 37.0 41.0 21 38.91825 41.0 41.0 41.0 32.0 41.0 22 36.573 41.0 37.0 41.0 27.0 41.0 23 39.13575 41.0 41.0 41.0 37.0 41.0 24 40.33625 41.0 41.0 41.0 41.0 41.0 25 35.07425 41.0 32.0 41.0 22.0 41.0 26 39.029 41.0 41.0 41.0 37.0 41.0 27 30.5755 37.0 22.0 41.0 12.0 41.0 28 36.1 41.0 37.0 41.0 22.0 41.0 29 38.71775 41.0 37.0 41.0 32.0 41.0 30 39.64125 41.0 41.0 41.0 37.0 41.0 31 33.1905 37.0 27.0 41.0 12.0 41.0 32 31.1965 37.0 22.0 41.0 12.0 41.0 33 30.15925 37.0 22.0 41.0 12.0 41.0 34 32.93075 37.0 27.0 41.0 12.0 41.0 35 37.4335 41.0 37.0 41.0 27.0 41.0 36 26.34025 27.0 12.0 37.0 12.0 41.0 37 29.50075 32.0 22.0 41.0 12.0 41.0 38 23.22225 22.0 12.0 37.0 12.0 41.0 39 23.405 22.0 12.0 32.0 12.0 37.0 40 32.01075 37.0 27.0 41.0 22.0 41.0 41 38.0955 41.0 37.0 41.0 32.0 41.0 42 33.32075 37.0 27.0 41.0 12.0 41.0 43 25.32125 27.0 12.0 37.0 12.0 41.0 44 24.21275 22.0 12.0 37.0 12.0 41.0 45 21.503 22.0 12.0 32.0 12.0 37.0 46 27.71275 27.0 22.0 37.0 12.0 41.0 47 24.01025 22.0 12.0 37.0 12.0 41.0 48 35.697 37.0 32.0 41.0 27.0 41.0 49 38.10475 41.0 37.0 41.0 32.0 41.0 50 39.722 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 7.0 24 11.0 25 25.0 26 45.0 27 56.0 28 82.0 29 116.0 30 150.0 31 228.0 32 341.0 33 496.0 34 565.0 35 638.0 36 574.0 37 382.0 38 209.0 39 63.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.425 8.649999999999999 7.5 42.425000000000004 2 24.341279799247175 9.937264742785445 36.587202007528234 29.134253450439147 3 23.400000000000002 14.475 23.150000000000002 38.975 4 28.4 21.05 20.775 29.775000000000002 5 29.125 27.0 22.025 21.85 6 25.724999999999998 29.375 23.400000000000002 21.5 7 19.275000000000002 23.724999999999998 39.35 17.65 8 26.3 21.625 28.225 23.849999999999998 9 20.175 21.675 33.0 25.15 10 24.474999999999998 33.825 24.4 17.299999999999997 11 25.85 25.45 24.075 24.625 12 24.525 21.725 27.55 26.200000000000003 13 26.1 26.450000000000003 24.75 22.7 14 25.35 23.875 26.924999999999997 23.849999999999998 15 23.9 24.725 25.924999999999997 25.45 16 27.900000000000002 25.374999999999996 22.7 24.025 17 23.45 25.775 25.5 25.275 18 23.1 24.525 25.674999999999997 26.700000000000003 19 27.6 25.324999999999996 23.474999999999998 23.599999999999998 20 23.275000000000002 26.174999999999997 26.375 24.175 21 23.5 25.525 25.924999999999997 25.05 22 25.775 25.374999999999996 25.05 23.799999999999997 23 23.799999999999997 25.55 26.200000000000003 24.45 24 22.35 26.3 25.45 25.900000000000002 25 28.275 23.849999999999998 23.974999999999998 23.9 26 23.025000000000002 25.7 25.775 25.5 27 27.975 23.375 24.224999999999998 24.425 28 25.05 24.25 26.375 24.325 29 23.9 24.349999999999998 25.025 26.724999999999998 30 22.875 25.724999999999998 25.2 26.200000000000003 31 28.325 23.75 23.5 24.425 32 27.075 25.324999999999996 23.825 23.775 33 27.075 24.125 23.5 25.3 34 25.05 24.6 23.825 26.525 35 22.725 25.324999999999996 26.875 25.074999999999996 36 27.625 22.45 26.974999999999998 22.95 37 27.85 23.5 23.625 25.025 38 27.6 23.325000000000003 27.325 21.75 39 27.875 24.25 23.799999999999997 24.075 40 25.55 24.474999999999998 24.825 25.15 41 23.65 24.375 25.025 26.950000000000003 42 26.525 25.424999999999997 22.625 25.424999999999997 43 28.025 23.175 25.8 23.0 44 28.449999999999996 23.150000000000002 24.95 23.45 45 26.55 23.849999999999998 27.075 22.525000000000002 46 27.775 23.925 24.15 24.15 47 27.925 24.2 25.3 22.575 48 22.325 25.4 25.474999999999998 26.8 49 24.9 25.1 24.325 25.674999999999997 50 23.25581395348837 25.006251562890725 25.881470367591895 25.85646411602901 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 2.5 24 3.0 25 3.5 26 4.0 27 5.5 28 7.0 29 13.0 30 19.0 31 29.5 32 40.0 33 48.0 34 56.0 35 71.0 36 86.0 37 116.5 38 147.0 39 163.5 40 180.0 41 210.5 42 241.0 43 265.0 44 289.0 45 306.5 46 324.0 47 327.5 48 331.0 49 343.5 50 356.0 51 347.5 52 339.0 53 332.5 54 326.0 55 301.5 56 277.0 57 255.0 58 233.0 59 199.0 60 165.0 61 162.0 62 159.0 63 145.5 64 132.0 65 113.0 66 94.0 67 77.0 68 60.0 69 51.0 70 42.0 71 36.0 72 30.0 73 26.5 74 23.0 75 17.5 76 12.0 77 10.0 78 8.0 79 6.5 80 5.0 81 3.0 82 1.0 83 0.5 84 0.0 85 1.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588226 READS because READLEN < 1 Read 1588226 spots for SRR6322354.sra Written 1588226 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra Rejected 1588222 READS because READLEN < 1 Read 1588222 spots for SRR6322354.sra Written 1588222 spots for SRR6322354.sra SRR ids: ['SRR6322354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0d0z2usi SRR6322354.sra spots: 31764444 blocks: [[1, 1588222], [1588223, 3176444], [3176445, 4764666], [4764667, 6352888], [6352889, 7941110], [7941111, 9529332], [9529333, 11117554], [11117555, 12705776], [12705777, 14293998], [14293999, 15882220], [15882221, 17470442], [17470443, 19058664], [19058665, 20646886], [20646887, 22235108], [22235109, 23823330], [23823331, 25411552], [25411553, 26999774], [26999775, 28587996], [28587997, 30176218], [30176219, 31764444]] SRR6322354 file size 4445174 SRR6322354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322354 SRR6322354_1.fastq Input file: SRR6322354_1.fastq trimmed: SRR6322354-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:41:42 2024 >> started Sat Dec 7 11:42:03 2024 >> done (21.043s) 31764444 reads processed; of these: 785 ( 0.00%) short reads filtered out after trimming by size control 81444 ( 0.26%) empty reads filtered out after trimming by size control 31682215 (99.74%) reads available; of these: 2109 ( 0.01%) trimmed reads available after processing 31680106 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 2096 0.01% 50 31680106 99.99% 31682215 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=19 prefix-density=0.10 prefix-fanout=3.1 sequence=CTCGTACTCGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=28.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.8 sequence=AGGGTCTTGTATGATTCTGCAGGAACATCAGCAAAGTATGTCTCAACAAGCACATTCAATCC Started job on | Dec 07 11:42:14 Started mapping on | Dec 07 11:42:15 Finished on | Dec 07 11:42:44 Mapping speed, Million of reads per hour | 3932.96 Number of input reads | 31682215 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 30659588 Uniquely mapped reads % | 96.77% Average mapped length | 49.85 Number of splices: Total | 4528852 Number of splices: Annotated (sjdb) | 4397684 Number of splices: GT/AG | 4478734 Number of splices: GC/AG | 43664 Number of splices: AT/AC | 2510 Number of splices: Non-canonical | 3944 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 656961 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 127114 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365666 365666 365666 N_multimapping 656961 656961 656961 N_noFeature 1136204 30041216 1281677 N_ambiguous 496386 1902 24679 UnstrandedReadsAssigned:29026998 PositiveStrandReadsAssigned:616470 NegativeStrandReadsAssigned:29353232 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322354 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322354-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,682,215 reads, 29,036,647 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR6322354.ke.tsv 35125 SRR6322354.se.tsv 88098 total ==> SRR6322354.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 135.017 10.7747 PNS24247 1044 945 28.4976 2.01427 PNS24249 1928 1829 11.262 0.411285 PNS24246 1044 945 28.4976 2.01427 PNS24248 1044 945 28.4976 2.01427 PNS24244 1471 1372 136.229 6.63217 PNS24243 293 194 0 0 KQK14069 1603 1504 7 0.310879 KQK14071 474 375 0 0 ==> SRR6322354.se.tsv <== BRADI_1g14170v3 8 BRADI_1g53295v3 20 BRADI_1g59795v3 314 BRADI_1g07683v3 0 BRADI_1g00485v3 1571 BRADI_1g20270v3 7256 BRADI_1g74790v3 5 BRADI_1g09890v3 27 BRADI_1g77505v3 85 BRADI_1g48960v3 0 SRR6322354 completed mapping pipeline successfully