Starting /dee2/code/volunteer_pipeline.sh SRR6322355 current disk space = 1544111521792 free memory = 1601413960 SRR6322355 SRAfilesize dcd67cc6ba43b7dfe19e0d329290cac8 SRR6322355.sra SRR6322355.sra file validated SRR6322355 is single end SRR6322355 is conventional basespace SRR6322355 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.64625 32.0 32.0 32.0 32.0 32.0 2 25.80625 32.0 12.0 32.0 12.0 32.0 3 33.53875 32.0 32.0 37.0 32.0 37.0 4 35.4125 37.0 37.0 37.0 32.0 37.0 5 36.54625 37.0 37.0 37.0 37.0 37.0 6 40.05775 41.0 41.0 41.0 37.0 41.0 7 32.37525 37.0 27.0 41.0 12.0 41.0 8 38.59675 41.0 37.0 41.0 32.0 41.0 9 38.895 41.0 37.0 41.0 32.0 41.0 10 40.13275 41.0 41.0 41.0 37.0 41.0 11 40.27125 41.0 41.0 41.0 41.0 41.0 12 40.0815 41.0 41.0 41.0 37.0 41.0 13 38.925 41.0 41.0 41.0 32.0 41.0 14 38.0135 41.0 37.0 41.0 32.0 41.0 15 39.488 41.0 41.0 41.0 37.0 41.0 16 36.188 41.0 37.0 41.0 22.0 41.0 17 39.543 41.0 41.0 41.0 37.0 41.0 18 40.3035 41.0 41.0 41.0 37.0 41.0 19 40.12275 41.0 41.0 41.0 37.0 41.0 20 36.28525 41.0 37.0 41.0 22.0 41.0 21 39.878 41.0 41.0 41.0 37.0 41.0 22 40.06525 41.0 41.0 41.0 37.0 41.0 23 38.39425 41.0 37.0 41.0 32.0 41.0 24 40.031 41.0 41.0 41.0 37.0 41.0 25 34.02875 37.0 27.0 41.0 12.0 41.0 26 37.50575 41.0 37.0 41.0 27.0 41.0 27 34.72775 41.0 32.0 41.0 12.0 41.0 28 30.32625 37.0 22.0 41.0 12.0 41.0 29 38.2285 41.0 37.0 41.0 32.0 41.0 30 33.748 37.0 27.0 41.0 12.0 41.0 31 39.203 41.0 41.0 41.0 37.0 41.0 32 28.554 32.0 12.0 41.0 12.0 41.0 33 33.613 37.0 27.0 41.0 12.0 41.0 34 31.1675 37.0 22.0 41.0 12.0 41.0 35 36.05225 41.0 37.0 41.0 22.0 41.0 36 24.6425 22.0 12.0 37.0 12.0 41.0 37 37.60275 41.0 37.0 41.0 32.0 41.0 38 38.941 41.0 41.0 41.0 37.0 41.0 39 33.41725 41.0 27.0 41.0 12.0 41.0 40 38.482 41.0 37.0 41.0 32.0 41.0 41 27.64175 32.0 12.0 41.0 12.0 41.0 42 37.75775 41.0 37.0 41.0 32.0 41.0 43 39.70125 41.0 41.0 41.0 37.0 41.0 44 38.7915 41.0 41.0 41.0 37.0 41.0 45 34.1115 41.0 32.0 41.0 12.0 41.0 46 38.64675 41.0 37.0 41.0 32.0 41.0 47 39.5415 41.0 41.0 41.0 37.0 41.0 48 39.31975 41.0 41.0 41.0 37.0 41.0 49 39.6035 41.0 41.0 41.0 37.0 41.0 50 38.6075 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 6.0 26 15.0 27 23.0 28 38.0 29 69.0 30 64.0 31 114.0 32 133.0 33 196.0 34 260.0 35 365.0 36 609.0 37 686.0 38 773.0 39 569.0 40 75.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.325 6.800000000000001 7.725 45.15 2 29.69972243250063 8.226091344940702 35.68004037345445 26.394145849104213 3 25.0 12.6 22.975 39.425 4 28.199999999999996 20.575 19.0 32.225 5 31.15 23.45 24.175 21.224999999999998 6 25.15 28.7 25.074999999999996 21.075 7 21.099999999999998 22.7 39.5 16.7 8 20.599999999999998 23.849999999999998 32.625 22.925 9 19.3 21.775 36.225 22.7 10 20.349999999999998 35.55 27.224999999999998 16.875 11 26.6 24.5 23.375 25.525 12 22.8 23.9 28.9 24.4 13 23.05 25.575 28.199999999999996 23.175 14 24.3 24.825 27.1 23.775 15 21.775 27.200000000000003 26.724999999999998 24.3 16 25.874999999999996 25.025 23.150000000000002 25.95 17 24.95 25.025 26.525 23.5 18 22.5 26.55 26.125 24.825 19 24.25 26.974999999999998 23.9 24.875 20 25.35 24.825 25.974999999999998 23.849999999999998 21 21.675 25.05 27.575 25.7 22 22.775000000000002 26.474999999999998 25.525 25.224999999999998 23 22.900000000000002 26.875 25.025 25.2 24 22.325 24.925 25.424999999999997 27.325 25 28.499999999999996 25.275 21.675 24.55 26 23.799999999999997 25.074999999999996 26.424999999999997 24.7 27 23.35 24.45 25.35 26.85 28 29.025000000000002 24.15 22.625 24.2 29 24.65 26.200000000000003 26.35 22.8 30 23.125 24.525 26.625 25.724999999999998 31 24.0 26.1 24.85 25.05 32 28.4 25.825 25.474999999999998 20.3 33 23.025000000000002 23.95 26.375 26.650000000000002 34 23.200000000000003 25.124999999999996 26.1 25.575 35 23.200000000000003 25.6 26.5 24.7 36 29.025000000000002 26.05 24.75 20.175 37 23.25 26.25 24.55 25.95 38 23.525 24.75 26.525 25.2 39 25.525 23.724999999999998 25.224999999999998 25.525 40 24.275 25.474999999999998 24.4 25.85 41 29.4 23.95 25.525 21.125 42 23.175 25.724999999999998 26.724999999999998 24.375 43 22.980745186296573 24.981245311327832 26.006501625406354 26.03150787696924 44 24.375 25.525 25.900000000000002 24.2 45 25.731432858214554 23.355838959739934 25.18129532383096 25.731432858214554 46 22.95 26.525 26.3 24.224999999999998 47 23.375 26.200000000000003 26.575 23.849999999999998 48 23.65 24.625 25.525 26.200000000000003 49 23.3 26.174999999999997 26.275 24.25 50 22.780695173793447 26.006501625406354 27.33183295823956 23.88097024256064 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.0 24 6.0 25 6.0 26 6.0 27 12.5 28 19.0 29 22.0 30 25.0 31 31.0 32 37.0 33 56.5 34 76.0 35 87.5 36 99.0 37 147.0 38 195.0 39 205.5 40 216.0 41 244.5 42 273.0 43 304.5 44 336.0 45 338.0 46 340.0 47 354.0 48 368.0 49 356.0 50 344.0 51 323.5 52 303.0 53 286.5 54 270.0 55 256.5 56 243.0 57 219.5 58 196.0 59 177.5 60 159.0 61 151.5 62 144.0 63 123.5 64 103.0 65 92.0 66 81.0 67 67.0 68 53.0 69 46.0 70 39.0 71 36.5 72 34.0 73 23.5 74 13.0 75 12.0 76 11.0 77 6.5 78 2.0 79 2.0 80 2.0 81 2.5 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.9249999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.025 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.63617677286743 95.0 2 2.055498458376156 4.0 3 0.2569373072970195 0.75 4 0.025693730729701953 0.1 5 0.0 0.0 6 0.025693730729701953 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555412 READS because READLEN < 1 Read 1555412 spots for SRR6322355.sra Written 1555412 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra Rejected 1555398 READS because READLEN < 1 Read 1555398 spots for SRR6322355.sra Written 1555398 spots for SRR6322355.sra SRR ids: ['SRR6322355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vc8jw9ja SRR6322355.sra spots: 31107974 blocks: [[1, 1555398], [1555399, 3110796], [3110797, 4666194], [4666195, 6221592], [6221593, 7776990], [7776991, 9332388], [9332389, 10887786], [10887787, 12443184], [12443185, 13998582], [13998583, 15553980], [15553981, 17109378], [17109379, 18664776], [18664777, 20220174], [20220175, 21775572], [21775573, 23330970], [23330971, 24886368], [24886369, 26441766], [26441767, 27997164], [27997165, 29552562], [29552563, 31107974]] SRR6322355 file size 4352858 SRR6322355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322355 SRR6322355_1.fastq Input file: SRR6322355_1.fastq trimmed: SRR6322355-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:42:30 2024 >> started Sat Dec 7 09:42:56 2024 >> done (25.421s) 31107974 reads processed; of these: 287 ( 0.00%) short reads filtered out after trimming by size control 105506 ( 0.34%) empty reads filtered out after trimming by size control 31002181 (99.66%) reads available; of these: 54 ( 0.00%) trimmed reads available after processing 31002127 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 50 0.00% 50 31002127 100.00% 31002181 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=28 prefix-density=0.07 prefix-fanout=2.0 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=27.99 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.4 sequence=TCAGCAGCACACATCAT Started job on | Dec 07 09:43:07 Started mapping on | Dec 07 09:43:07 Finished on | Dec 07 09:43:36 Mapping speed, Million of reads per hour | 3848.55 Number of input reads | 31002181 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 30016844 Uniquely mapped reads % | 96.82% Average mapped length | 49.86 Number of splices: Total | 4412872 Number of splices: Annotated (sjdb) | 4306665 Number of splices: GT/AG | 4362089 Number of splices: GC/AG | 44906 Number of splices: AT/AC | 2538 Number of splices: Non-canonical | 3339 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 603183 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 88029 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 382154 382154 382154 N_multimapping 603183 603183 603183 N_noFeature 1238684 29369082 1396689 N_ambiguous 512299 1694 23544 UnstrandedReadsAssigned:28265861 PositiveStrandReadsAssigned:646068 NegativeStrandReadsAssigned:28596611 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322355 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322355-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,002,181 reads, 27,912,600 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6322355.ke.tsv 35125 SRR6322355.se.tsv 88098 total ==> SRR6322355.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 202.004 17.5634 PNS24247 1044 945 42.0411 3.23755 PNS24249 1928 1829 12.0066 0.477727 PNS24246 1044 945 42.0411 3.23755 PNS24248 1044 945 42.0411 3.23755 PNS24244 1471 1372 66.8661 3.54672 PNS24243 293 194 0 0 KQK14069 1603 1504 7.99291 0.386752 KQK14071 474 375 1.04391 0.202585 ==> SRR6322355.se.tsv <== BRADI_1g14170v3 9 BRADI_1g53295v3 43 BRADI_1g59795v3 359 BRADI_1g07683v3 0 BRADI_1g00485v3 1305 BRADI_1g20270v3 4656 BRADI_1g74790v3 12 BRADI_1g09890v3 19 BRADI_1g77505v3 113 BRADI_1g48960v3 0 SRR6322355 completed mapping pipeline successfully