Starting /dee2/code/volunteer_pipeline.sh SRR6322356 current disk space = 1544056889344 free memory = 1601390692 SRR6322356 SRAfilesize a756c7a0f4601314d12b6967415078f1 SRR6322356.sra SRR6322356.sra file validated SRR6322356 is single end SRR6322356 is conventional basespace SRR6322356 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.84375 32.0 32.0 32.0 32.0 32.0 2 31.375 32.0 32.0 32.0 32.0 32.0 3 35.62125 37.0 37.0 37.0 32.0 37.0 4 36.385 37.0 37.0 37.0 37.0 37.0 5 36.735 37.0 37.0 37.0 37.0 37.0 6 40.29375 41.0 41.0 41.0 37.0 41.0 7 40.2275 41.0 41.0 41.0 37.0 41.0 8 33.56675 37.0 32.0 41.0 12.0 41.0 9 36.89475 41.0 37.0 41.0 27.0 41.0 10 34.23175 37.0 32.0 41.0 12.0 41.0 11 39.7365 41.0 41.0 41.0 37.0 41.0 12 38.4455 41.0 37.0 41.0 32.0 41.0 13 35.517 41.0 32.0 41.0 22.0 41.0 14 35.497 41.0 32.0 41.0 22.0 41.0 15 39.31575 41.0 41.0 41.0 37.0 41.0 16 35.21475 41.0 32.0 41.0 22.0 41.0 17 39.9485 41.0 41.0 41.0 37.0 41.0 18 40.36475 41.0 41.0 41.0 41.0 41.0 19 36.39575 41.0 37.0 41.0 22.0 41.0 20 39.0685 41.0 41.0 41.0 37.0 41.0 21 38.986 41.0 41.0 41.0 37.0 41.0 22 36.34925 41.0 37.0 41.0 27.0 41.0 23 39.34125 41.0 41.0 41.0 37.0 41.0 24 40.356 41.0 41.0 41.0 41.0 41.0 25 34.7815 41.0 32.0 41.0 22.0 41.0 26 39.06875 41.0 41.0 41.0 37.0 41.0 27 30.448 37.0 22.0 41.0 12.0 41.0 28 36.20725 41.0 37.0 41.0 27.0 41.0 29 38.8905 41.0 41.0 41.0 37.0 41.0 30 39.73225 41.0 41.0 41.0 37.0 41.0 31 33.37 41.0 27.0 41.0 12.0 41.0 32 31.50275 37.0 22.0 41.0 12.0 41.0 33 30.12875 37.0 22.0 41.0 12.0 41.0 34 32.8385 37.0 27.0 41.0 12.0 41.0 35 37.3645 41.0 37.0 41.0 27.0 41.0 36 26.3245 27.0 12.0 37.0 12.0 41.0 37 29.142 32.0 22.0 41.0 12.0 41.0 38 23.11775 22.0 12.0 37.0 12.0 41.0 39 23.28975 22.0 12.0 32.0 12.0 37.0 40 32.243 37.0 27.0 41.0 22.0 41.0 41 38.09875 41.0 37.0 41.0 32.0 41.0 42 33.4075 37.0 27.0 41.0 12.0 41.0 43 25.03075 27.0 12.0 37.0 12.0 41.0 44 24.233 22.0 12.0 37.0 12.0 41.0 45 21.6265 22.0 12.0 32.0 12.0 37.0 46 28.00825 27.0 22.0 37.0 12.0 41.0 47 24.36775 22.0 12.0 37.0 12.0 41.0 48 35.8195 37.0 32.0 41.0 27.0 41.0 49 37.94175 41.0 37.0 41.0 32.0 41.0 50 39.56375 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 6.0 25 13.0 26 32.0 27 61.0 28 78.0 29 114.0 30 190.0 31 274.0 32 319.0 33 476.0 34 551.0 35 628.0 36 569.0 37 399.0 38 203.0 39 69.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.325 8.15 7.6499999999999995 41.875 2 26.63656884875846 11.43717080511663 33.559066967644846 28.36719337848006 3 25.074999999999996 14.6 23.775 36.55 4 30.075000000000003 19.775000000000002 20.0 30.15 5 29.45 25.45 23.625 21.475 6 26.0 29.775000000000002 23.35 20.875 7 20.1 22.900000000000002 38.324999999999996 18.675 8 26.0 21.8 27.975 24.224999999999998 9 22.325 20.849999999999998 33.0 23.825 10 25.05 33.35 22.975 18.625 11 26.125 25.775 22.55 25.55 12 24.975 21.75 26.900000000000002 26.375 13 27.0 24.75 24.5 23.75 14 25.4 25.575 25.5 23.525 15 23.0 26.424999999999997 24.925 25.650000000000002 16 28.65 23.25 21.425 26.674999999999997 17 23.674999999999997 26.325 24.525 25.474999999999998 18 23.175 24.2 26.5 26.125 19 27.3 25.324999999999996 22.375 25.0 20 24.099999999999998 25.2 26.400000000000002 24.3 21 23.849999999999998 25.4 26.525 24.224999999999998 22 25.900000000000002 25.424999999999997 23.3 25.374999999999996 23 23.45 25.1 25.424999999999997 26.025 24 23.575 27.35 23.599999999999998 25.474999999999998 25 28.95 23.599999999999998 22.975 24.474999999999998 26 23.724999999999998 24.95 24.4 26.924999999999997 27 27.925 23.325000000000003 24.2 24.55 28 26.025 24.25 23.575 26.150000000000002 29 23.95 26.700000000000003 24.3 25.05 30 25.5 23.925 24.85 25.724999999999998 31 29.025000000000002 23.65 22.25 25.074999999999996 32 28.199999999999996 24.85 23.275000000000002 23.674999999999997 33 26.85 22.85 24.725 25.575 34 27.500000000000004 22.6 24.425 25.474999999999998 35 25.825 25.525 24.325 24.325 36 27.650000000000002 22.400000000000002 27.125 22.825 37 29.099999999999998 23.65 22.225 25.025 38 27.150000000000002 23.95 27.400000000000002 21.5 39 28.549999999999997 23.1 24.6 23.75 40 25.474999999999998 24.625 24.55 25.35 41 24.349999999999998 25.874999999999996 25.224999999999998 24.55 42 26.400000000000002 23.7 23.674999999999997 26.224999999999998 43 27.875 23.95 25.8 22.375 44 29.725 23.75 24.525 22.0 45 27.675 23.775 26.325 22.225 46 29.15 23.5 21.75 25.6 47 27.750000000000004 25.95 25.15 21.15 48 23.05 24.575 25.3 27.075 49 26.525 23.45 25.0 25.025 50 23.575 25.174999999999997 25.2 26.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 4.0 25 5.0 26 6.0 27 8.5 28 11.0 29 16.0 30 21.0 31 29.0 32 37.0 33 44.5 34 52.0 35 71.5 36 91.0 37 102.0 38 113.0 39 153.0 40 193.0 41 216.0 42 239.0 43 265.0 44 291.0 45 294.5 46 298.0 47 297.0 48 296.0 49 325.5 50 355.0 51 341.5 52 328.0 53 314.5 54 301.0 55 272.5 56 244.0 57 238.5 58 233.0 59 215.5 60 198.0 61 173.5 62 149.0 63 137.5 64 126.0 65 119.5 66 113.0 67 99.5 68 86.0 69 74.5 70 63.0 71 60.0 72 57.0 73 46.5 74 36.0 75 31.0 76 26.0 77 19.0 78 12.0 79 8.5 80 5.0 81 4.5 82 4.0 83 3.0 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707581 READS because READLEN < 1 Read 1707581 spots for SRR6322356.sra Written 1707581 spots for SRR6322356.sra Rejected 1707588 READS because READLEN < 1 Read 1707588 spots for SRR6322356.sra Written 1707588 spots for SRR6322356.sra SRR ids: ['SRR6322356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hrfc7zeq SRR6322356.sra spots: 34151627 blocks: [[1, 1707581], [1707582, 3415162], [3415163, 5122743], [5122744, 6830324], [6830325, 8537905], [8537906, 10245486], [10245487, 11953067], [11953068, 13660648], [13660649, 15368229], [15368230, 17075810], [17075811, 18783391], [18783392, 20490972], [20490973, 22198553], [22198554, 23906134], [23906135, 25613715], [25613716, 27321296], [27321297, 29028877], [29028878, 30736458], [30736459, 32444039], [32444040, 34151627]] SRR6322356 file size 4780872 SRR6322356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322356 SRR6322356_1.fastq Input file: SRR6322356_1.fastq trimmed: SRR6322356-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:43:17 2024 >> started Sat Dec 7 09:43:28 2024 >> done (10.996s) 34151627 reads processed; of these: 684 ( 0.00%) short reads filtered out after trimming by size control 183966 ( 0.54%) empty reads filtered out after trimming by size control 33966977 (99.46%) reads available; of these: 2427 ( 0.01%) trimmed reads available after processing 33964550 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 2409 0.01% 50 33964550 99.99% 33966977 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=28 prefix-density=0.08 prefix-fanout=2.4 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=41.62 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.9 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 09:43:37 Started mapping on | Dec 07 09:43:37 Finished on | Dec 07 09:44:06 Mapping speed, Million of reads per hour | 4216.59 Number of input reads | 33966977 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 32883731 Uniquely mapped reads % | 96.81% Average mapped length | 49.84 Number of splices: Total | 4513848 Number of splices: Annotated (sjdb) | 4375878 Number of splices: GT/AG | 4458466 Number of splices: GC/AG | 47895 Number of splices: AT/AC | 2702 Number of splices: Non-canonical | 4785 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 616620 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 112665 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466626 466626 466626 N_multimapping 616620 616620 616620 N_noFeature 1222054 32168441 1422797 N_ambiguous 538527 1913 25166 UnstrandedReadsAssigned:31123150 PositiveStrandReadsAssigned:713377 NegativeStrandReadsAssigned:31435768 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322356 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322356-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,966,977 reads, 31,013,879 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR6322356.ke.tsv 35125 SRR6322356.se.tsv 88098 total ==> SRR6322356.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 143.542 10.3577 PNS24247 1044 945 37.2281 2.3793 PNS24249 1928 1829 46.9738 1.55114 PNS24246 1044 945 37.2281 2.3793 PNS24248 1044 945 37.2281 2.3793 PNS24244 1471 1372 55.8 2.45635 PNS24243 293 194 0 0 KQK14069 1603 1504 7.99291 0.320972 KQK14071 474 375 1.00709 0.162198 ==> SRR6322356.se.tsv <== BRADI_1g14170v3 9 BRADI_1g53295v3 26 BRADI_1g59795v3 335 BRADI_1g07683v3 0 BRADI_1g00485v3 1012 BRADI_1g20270v3 3363 BRADI_1g74790v3 47 BRADI_1g09890v3 95 BRADI_1g77505v3 98 BRADI_1g48960v3 0 SRR6322356 completed mapping pipeline successfully