Starting /dee2/code/volunteer_pipeline.sh SRR6322357 current disk space = 1542931759104 free memory = 1599550736 SRR6322357 SRAfilesize 5ac1e7324cef37159ab21eb4ac4c1ffe SRR6322357.sra SRR6322357.sra file validated SRR6322357 is single end SRR6322357 is conventional basespace SRR6322357 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.347 33.0 33.0 34.0 31.0 34.0 2 32.74925 34.0 33.0 34.0 31.0 34.0 3 32.83175 34.0 33.0 34.0 31.0 34.0 4 32.9825 34.0 33.0 34.0 32.0 34.0 5 33.03975 34.0 33.0 34.0 32.0 34.0 6 36.62325 38.0 37.0 38.0 34.0 38.0 7 37.06975 38.0 38.0 38.0 35.0 38.0 8 37.1485 38.0 38.0 38.0 36.0 38.0 9 37.21675 38.0 38.0 38.0 36.0 38.0 10 37.3085 38.0 38.0 38.0 36.0 38.0 11 37.2655 38.0 38.0 38.0 36.0 38.0 12 37.08875 38.0 38.0 38.0 36.0 38.0 13 37.12575 38.0 38.0 38.0 36.0 38.0 14 37.06675 38.0 38.0 38.0 35.0 38.0 15 36.98925 38.0 38.0 38.0 35.0 38.0 16 36.918 38.0 38.0 38.0 35.0 38.0 17 36.99525 38.0 38.0 38.0 35.0 38.0 18 36.868 38.0 38.0 38.0 34.0 38.0 19 36.846 38.0 38.0 38.0 34.0 38.0 20 36.80375 38.0 38.0 38.0 34.0 38.0 21 36.73475 38.0 38.0 38.0 34.0 38.0 22 36.7275 38.0 38.0 38.0 34.0 38.0 23 36.464 38.0 37.0 38.0 34.0 38.0 24 36.67975 38.0 38.0 38.0 34.0 38.0 25 36.92575 38.0 38.0 38.0 35.0 38.0 26 37.0615 38.0 38.0 38.0 36.0 38.0 27 37.01125 38.0 38.0 38.0 35.0 38.0 28 37.03 38.0 38.0 38.0 36.0 38.0 29 36.953 38.0 38.0 38.0 35.0 38.0 30 36.86175 38.0 38.0 38.0 35.0 38.0 31 36.66525 38.0 38.0 38.0 34.0 38.0 32 36.42225 38.0 37.0 38.0 33.0 38.0 33 36.37625 38.0 37.0 38.0 34.0 38.0 34 36.22975 38.0 37.0 38.0 33.0 38.0 35 36.313 38.0 37.0 38.0 33.0 38.0 36 36.46425 38.0 37.0 38.0 34.0 38.0 37 36.56 38.0 37.0 38.0 34.0 38.0 38 36.77475 38.0 38.0 38.0 34.0 38.0 39 36.912 38.0 38.0 38.0 35.0 38.0 40 36.96775 38.0 38.0 38.0 35.0 38.0 41 37.07775 38.0 38.0 38.0 35.0 38.0 42 37.114 38.0 38.0 38.0 36.0 38.0 43 37.09575 38.0 38.0 38.0 36.0 38.0 44 37.11225 38.0 38.0 38.0 36.0 38.0 45 37.16025 38.0 38.0 38.0 36.0 38.0 46 37.222 38.0 38.0 38.0 36.0 38.0 47 37.321 38.0 38.0 38.0 36.0 38.0 48 37.2475 38.0 38.0 38.0 37.0 38.0 49 37.21925 38.0 38.0 38.0 37.0 38.0 50 37.195 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.0 26 3.0 27 10.0 28 15.0 29 22.0 30 37.0 31 64.0 32 71.0 33 119.0 34 176.0 35 294.0 36 823.0 37 2359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.657866948257656 9.213305174234424 8.474128827877509 40.65469904963041 2 22.975 10.975 33.4 32.65 3 21.655413853463365 13.12828207051763 25.206301575393848 40.010002500625156 4 26.900000000000002 17.825 22.025 33.25 5 27.224999999999998 23.775 25.025 23.974999999999998 6 24.474999999999998 27.900000000000002 23.925 23.7 7 20.549999999999997 24.3 36.0 19.15 8 21.95 23.549999999999997 31.25 23.25 9 21.825 21.525 32.875 23.775 10 20.375 32.125 27.55 19.950000000000003 11 26.375 26.125 22.55 24.95 12 25.275 21.95 25.2 27.575 13 23.3 24.875 26.900000000000002 24.925 14 23.1 25.650000000000002 26.525 24.725 15 21.7 25.124999999999996 27.125 26.05 16 23.575 24.65 25.224999999999998 26.55 17 23.75 25.6 25.474999999999998 25.174999999999997 18 22.85 24.675 26.5 25.974999999999998 19 24.4 24.349999999999998 25.174999999999997 26.075 20 22.35 25.8 26.125 25.724999999999998 21 23.625 23.3 26.8 26.275 22 23.599999999999998 25.174999999999997 24.3 26.924999999999997 23 23.025000000000002 26.125 25.6 25.25 24 22.475 24.625 25.45 27.450000000000003 25 21.625 25.8 24.95 27.625 26 23.125 25.324999999999996 25.624999999999996 25.924999999999997 27 23.0 24.099999999999998 26.35 26.55 28 23.35 24.25 26.25 26.150000000000002 29 23.1 24.349999999999998 26.650000000000002 25.900000000000002 30 22.25 23.849999999999998 26.200000000000003 27.700000000000003 31 24.3 24.45 24.725 26.525 32 21.275 26.450000000000003 26.375 25.900000000000002 33 22.85 24.6 26.674999999999997 25.874999999999996 34 25.5 23.200000000000003 25.825 25.474999999999998 35 23.775 25.95 25.05 25.224999999999998 36 22.525000000000002 24.55 25.7 27.224999999999998 37 23.1 25.05 25.374999999999996 26.474999999999998 38 23.549999999999997 24.425 26.275 25.75 39 22.6 24.625 25.95 26.825 40 23.225 25.474999999999998 26.275 25.025 41 25.025 24.5 26.075 24.4 42 23.275000000000002 24.0 25.074999999999996 27.650000000000002 43 23.775 24.4 25.275 26.55 44 23.549999999999997 25.0 25.124999999999996 26.325 45 23.325000000000003 24.5 24.525 27.650000000000002 46 23.724999999999998 24.474999999999998 24.474999999999998 27.325 47 23.25 24.275 27.975 24.5 48 22.6 24.675 26.775 25.95 49 23.65 24.375 25.35 26.625 50 22.725 25.4 24.625 27.250000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 4.0 26 5.0 27 9.5 28 14.0 29 19.0 30 24.0 31 32.5 32 41.0 33 59.0 34 77.0 35 96.0 36 115.0 37 148.5 38 182.0 39 201.5 40 221.0 41 258.5 42 296.0 43 306.5 44 317.0 45 319.0 46 321.0 47 326.5 48 332.0 49 315.5 50 299.0 51 296.0 52 293.0 53 272.5 54 252.0 55 260.5 56 269.0 57 233.0 58 197.0 59 185.5 60 174.0 61 160.0 62 146.0 63 134.0 64 122.0 65 113.5 66 105.0 67 79.5 68 54.0 69 47.0 70 40.0 71 38.5 72 37.0 73 36.0 74 35.0 75 22.0 76 9.0 77 9.5 78 10.0 79 6.5 80 3.0 81 3.0 82 3.0 83 1.5 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.3 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.757002271006813 1.5 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra Read 864158 spots for SRR6322357.sra Written 864158 spots for SRR6322357.sra SRR ids: ['SRR6322357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wtq4z6d5 SRR6322357.sra spots: 17283160 blocks: [[1, 864158], [864159, 1728316], [1728317, 2592474], [2592475, 3456632], [3456633, 4320790], [4320791, 5184948], [5184949, 6049106], [6049107, 6913264], [6913265, 7777422], [7777423, 8641580], [8641581, 9505738], [9505739, 10369896], [10369897, 11234054], [11234055, 12098212], [12098213, 12962370], [12962371, 13826528], [13826529, 14690686], [14690687, 15554844], [15554845, 16419002], [16419003, 17283160]] SRR6322357 file size 3001735 SRR6322357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322357 SRR6322357_1.fastq Input file: SRR6322357_1.fastq trimmed: SRR6322357-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:41:44 2024 >> started Sat Dec 7 11:41:52 2024 >> done (8.936s) 17283160 reads processed; of these: 276 ( 0.00%) short reads filtered out after trimming by size control 333 ( 0.00%) empty reads filtered out after trimming by size control 17282551 (100.00%) reads available; of these: 94344 ( 0.55%) trimmed reads available after processing 17188207 (99.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 56 0.00% 19 54 0.00% 20 80 0.00% 21 135 0.00% 22 185 0.00% 23 522 0.00% 24 339 0.00% 25 447 0.00% 26 600 0.00% 27 693 0.00% 28 899 0.01% 29 1013 0.01% 30 1342 0.01% 31 2133 0.01% 32 4665 0.03% 33 25741 0.15% 34 6589 0.04% 35 757 0.00% 36 438 0.00% 37 437 0.00% 38 519 0.00% 39 572 0.00% 40 741 0.00% 41 862 0.00% 42 1087 0.01% 43 1419 0.01% 44 1948 0.01% 45 2620 0.02% 46 3605 0.02% 47 5893 0.03% 48 10481 0.06% 49 17472 0.10% 50 17188207 99.45% 17282551 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=81.80 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.4 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 11:42:03 Started mapping on | Dec 07 11:42:03 Finished on | Dec 07 11:42:26 Mapping speed, Million of reads per hour | 2705.09 Number of input reads | 17282551 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16017887 Uniquely mapped reads % | 92.68% Average mapped length | 49.80 Number of splices: Total | 2427742 Number of splices: Annotated (sjdb) | 2335880 Number of splices: GT/AG | 2399993 Number of splices: GC/AG | 22328 Number of splices: AT/AC | 1566 Number of splices: Non-canonical | 3855 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424182 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 409591 % of reads mapped to too many loci | 2.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 840482 840482 840482 N_multimapping 424182 424182 424182 N_noFeature 737745 15548919 827160 N_ambiguous 407312 1093 28931 UnstrandedReadsAssigned:14872830 PositiveStrandReadsAssigned:467875 NegativeStrandReadsAssigned:15161796 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322357 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322357-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,282,551 reads, 14,643,100 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6322357.ke.tsv 35125 SRR6322357.se.tsv 88098 total ==> SRR6322357.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 36.9567 4.56703 PNS24249 1928 1829 3.68963 0.235582 PNS24246 1044 945 36.9567 4.56703 PNS24248 1044 945 36.9567 4.56703 PNS24244 1471 1372 35.4403 3.01658 PNS24243 293 194 0 0 KQK14069 1603 1504 3421.44 265.664 KQK14071 474 375 624.489 194.476 ==> SRR6322357.se.tsv <== BRADI_1g14170v3 4359 BRADI_1g53295v3 98 BRADI_1g59795v3 239 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 6939 BRADI_1g74790v3 13 BRADI_1g09890v3 0 BRADI_1g77505v3 199 BRADI_1g48960v3 0 SRR6322357 completed mapping pipeline successfully