Starting /dee2/code/volunteer_pipeline.sh SRR6322358 current disk space = 1542972108800 free memory = 1590528064 SRR6322358 SRAfilesize 2a0cc46e96bdc058ef716247f5881029 SRR6322358.sra SRR6322358.sra file validated SRR6322358 is single end SRR6322358 is conventional basespace SRR6322358 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62 33.0 33.0 34.0 31.0 34.0 2 32.83225 34.0 33.0 34.0 31.0 34.0 3 32.894 34.0 33.0 34.0 32.0 34.0 4 33.0405 34.0 33.0 34.0 32.0 34.0 5 33.0675 34.0 33.0 34.0 32.0 34.0 6 36.64725 38.0 37.0 38.0 34.0 38.0 7 37.09225 38.0 38.0 38.0 36.0 38.0 8 37.19025 38.0 38.0 38.0 36.0 38.0 9 37.25275 38.0 38.0 38.0 36.0 38.0 10 37.31625 38.0 38.0 38.0 37.0 38.0 11 37.24375 38.0 38.0 38.0 36.0 38.0 12 37.0675 38.0 38.0 38.0 35.0 38.0 13 37.0165 38.0 38.0 38.0 35.0 38.0 14 36.96475 38.0 38.0 38.0 35.0 38.0 15 37.078 38.0 38.0 38.0 36.0 38.0 16 36.91375 38.0 38.0 38.0 35.0 38.0 17 36.88525 38.0 38.0 38.0 35.0 38.0 18 36.88625 38.0 38.0 38.0 35.0 38.0 19 36.73725 38.0 38.0 38.0 35.0 38.0 20 36.77225 38.0 38.0 38.0 34.0 38.0 21 36.70175 38.0 38.0 38.0 34.0 38.0 22 36.517 38.0 38.0 38.0 34.0 38.0 23 36.451 38.0 37.0 38.0 34.0 38.0 24 36.59375 38.0 38.0 38.0 34.0 38.0 25 36.83775 38.0 38.0 38.0 35.0 38.0 26 37.0355 38.0 38.0 38.0 35.0 38.0 27 37.028 38.0 38.0 38.0 35.0 38.0 28 37.028 38.0 38.0 38.0 36.0 38.0 29 36.798 38.0 38.0 38.0 35.0 38.0 30 36.7795 38.0 38.0 38.0 35.0 38.0 31 36.5395 38.0 38.0 38.0 34.0 38.0 32 36.17625 38.0 37.0 38.0 33.0 38.0 33 36.19875 38.0 37.0 38.0 33.0 38.0 34 36.02425 38.0 37.0 38.0 33.0 38.0 35 36.058 38.0 37.0 38.0 33.0 38.0 36 36.15425 38.0 37.0 38.0 33.0 38.0 37 36.3215 38.0 37.0 38.0 34.0 38.0 38 36.52125 38.0 37.0 38.0 34.0 38.0 39 36.68275 38.0 38.0 38.0 35.0 38.0 40 36.73475 38.0 38.0 38.0 35.0 38.0 41 36.812 38.0 38.0 38.0 35.0 38.0 42 36.8855 38.0 38.0 38.0 35.0 38.0 43 36.91725 38.0 38.0 38.0 36.0 38.0 44 36.96025 38.0 38.0 38.0 36.0 38.0 45 36.951 38.0 38.0 38.0 36.0 38.0 46 37.04475 38.0 38.0 38.0 36.0 38.0 47 37.06875 38.0 38.0 38.0 36.0 38.0 48 37.0635 38.0 38.0 38.0 36.0 38.0 49 37.1145 38.0 38.0 38.0 36.0 38.0 50 37.0225 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 1.0 19 0.0 20 3.0 21 2.0 22 2.0 23 5.0 24 3.0 25 6.0 26 6.0 27 14.0 28 20.0 29 26.0 30 43.0 31 53.0 32 87.0 33 109.0 34 171.0 35 274.0 36 830.0 37 2343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.30109775222164 8.625196027182437 7.736539466806064 35.33716675378986 2 22.825 10.424999999999999 35.699999999999996 31.05 3 20.80520130032508 17.22930732683171 25.256314078519633 36.70917729432358 4 26.224999999999998 21.525 22.3 29.95 5 25.374999999999996 28.025 23.325000000000003 23.275000000000002 6 23.7 31.0 22.925 22.375 7 17.925 24.8 37.875 19.400000000000002 8 20.9 23.150000000000002 29.75 26.200000000000003 9 21.7 21.9 32.05 24.349999999999998 10 21.325 34.1 24.625 19.950000000000003 11 26.25 25.174999999999997 22.2 26.375 12 24.3 23.025000000000002 26.0 26.674999999999997 13 23.05 24.125 28.749999999999996 24.075 14 21.9 25.4 27.05 25.650000000000002 15 23.175 24.9 26.825 25.1 16 23.825 24.05 27.125 25.0 17 23.925 25.45 24.85 25.775 18 23.5 25.224999999999998 24.5 26.775 19 24.3 25.324999999999996 26.224999999999998 24.15 20 22.475 26.474999999999998 25.75 25.3 21 23.375 24.75 25.3 26.575 22 23.200000000000003 25.15 26.075 25.575 23 23.225 24.474999999999998 27.375 24.925 24 22.925 25.974999999999998 25.650000000000002 25.45 25 22.275 26.150000000000002 25.85 25.724999999999998 26 23.375 25.1 25.724999999999998 25.8 27 22.925 24.575 25.974999999999998 26.525 28 23.35 25.874999999999996 25.0 25.775 29 23.175 25.0 25.474999999999998 26.35 30 22.125 27.500000000000004 24.224999999999998 26.150000000000002 31 24.5 25.575 24.875 25.05 32 23.400000000000002 26.575 25.674999999999997 24.349999999999998 33 22.925 25.424999999999997 25.974999999999998 25.674999999999997 34 23.175 27.125 24.4 25.3 35 22.025 25.900000000000002 25.5 26.575 36 23.075000000000003 25.624999999999996 24.95 26.35 37 22.425 26.375 25.874999999999996 25.324999999999996 38 23.95 24.975 26.400000000000002 24.675 39 22.675 24.325 25.95 27.05 40 23.425 25.75 25.525 25.3 41 23.125 26.825 25.1 24.95 42 23.474999999999998 25.424999999999997 26.275 24.825 43 24.175 25.074999999999996 25.4 25.35 44 23.7 25.374999999999996 25.374999999999996 25.55 45 22.5 26.525 24.9 26.075 46 23.175 25.95 25.4 25.474999999999998 47 22.125 25.224999999999998 26.924999999999997 25.724999999999998 48 22.05 26.1 26.075 25.775 49 24.099999999999998 25.874999999999996 24.95 25.074999999999996 50 23.75 24.75 25.650000000000002 25.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 3.5 22 4.0 23 3.0 24 2.0 25 6.0 26 10.0 27 17.5 28 25.0 29 30.5 30 36.0 31 50.5 32 65.0 33 79.5 34 94.0 35 116.5 36 139.0 37 160.0 38 181.0 39 208.0 40 235.0 41 262.5 42 290.0 43 306.0 44 322.0 45 338.5 46 355.0 47 344.0 48 333.0 49 317.0 50 301.0 51 289.0 52 277.0 53 246.0 54 215.0 55 214.5 56 214.0 57 203.0 58 192.0 59 174.5 60 157.0 61 143.0 62 129.0 63 130.5 64 132.0 65 110.0 66 88.0 67 79.5 68 71.0 69 67.0 70 63.0 71 44.0 72 25.0 73 22.0 74 19.0 75 13.5 76 8.0 77 7.0 78 6.0 79 6.5 80 7.0 81 4.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.35 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778158 spots for SRR6322358.sra Written 778158 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra Read 778141 spots for SRR6322358.sra Written 778141 spots for SRR6322358.sra SRR ids: ['SRR6322358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9brllgq8 SRR6322358.sra spots: 15562837 blocks: [[1, 778141], [778142, 1556282], [1556283, 2334423], [2334424, 3112564], [3112565, 3890705], [3890706, 4668846], [4668847, 5446987], [5446988, 6225128], [6225129, 7003269], [7003270, 7781410], [7781411, 8559551], [8559552, 9337692], [9337693, 10115833], [10115834, 10893974], [10893975, 11672115], [11672116, 12450256], [12450257, 13228397], [13228398, 14006538], [14006539, 14784679], [14784680, 15562837]] SRR6322358 file size 2701872 SRR6322358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322358 SRR6322358_1.fastq Input file: SRR6322358_1.fastq trimmed: SRR6322358-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:42:25 2024 >> started Sat Dec 7 11:42:38 2024 >> done (13.049s) 15562837 reads processed; of these: 303 ( 0.00%) short reads filtered out after trimming by size control 701 ( 0.00%) empty reads filtered out after trimming by size control 15561833 (99.99%) reads available; of these: 127798 ( 0.82%) trimmed reads available after processing 15434035 (99.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 75 0.00% 19 90 0.00% 20 144 0.00% 21 151 0.00% 22 305 0.00% 23 602 0.00% 24 488 0.00% 25 640 0.00% 26 898 0.01% 27 1092 0.01% 28 1544 0.01% 29 1732 0.01% 30 2399 0.02% 31 3788 0.02% 32 8389 0.05% 33 46094 0.30% 34 11253 0.07% 35 1147 0.01% 36 633 0.00% 37 502 0.00% 38 548 0.00% 39 612 0.00% 40 733 0.00% 41 889 0.01% 42 1180 0.01% 43 1375 0.01% 44 1855 0.01% 45 2537 0.02% 46 3676 0.02% 47 5602 0.04% 48 10106 0.06% 49 16719 0.11% 50 15434035 99.18% 15561833 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=28 prefix-density=0.00 prefix-fanout=1.0 sequence=TCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=12.63 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=CGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGT Started job on | Dec 07 11:42:47 Started mapping on | Dec 07 11:42:47 Finished on | Dec 07 11:43:07 Mapping speed, Million of reads per hour | 2801.13 Number of input reads | 15561833 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 14675936 Uniquely mapped reads % | 94.31% Average mapped length | 49.80 Number of splices: Total | 2121645 Number of splices: Annotated (sjdb) | 2042698 Number of splices: GT/AG | 2094400 Number of splices: GC/AG | 22492 Number of splices: AT/AC | 1176 Number of splices: Non-canonical | 3577 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411832 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 313935 % of reads mapped to too many loci | 2.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474065 474065 474065 N_multimapping 411832 411832 411832 N_noFeature 773480 14349441 871212 N_ambiguous 245363 793 17143 UnstrandedReadsAssigned:13657093 PositiveStrandReadsAssigned:325702 NegativeStrandReadsAssigned:13787581 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322358 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322358-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,561,833 reads, 13,310,909 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR6322358.ke.tsv 35125 SRR6322358.se.tsv 88098 total ==> SRR6322358.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 30.363 4.74215 PNS24247 1044 945 36.8754 5.10107 PNS24249 1928 1829 0 0 PNS24246 1044 945 36.8754 5.10107 PNS24248 1044 945 36.8754 5.10107 PNS24244 1471 1372 124.011 11.8158 PNS24243 293 194 0 0 KQK14069 1603 1504 4600.47 399.862 KQK14071 474 375 873.08 304.354 ==> SRR6322358.se.tsv <== BRADI_1g14170v3 6200 BRADI_1g53295v3 279 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2017 BRADI_1g74790v3 284 BRADI_1g09890v3 0 BRADI_1g77505v3 192 BRADI_1g48960v3 0 SRR6322358 completed mapping pipeline successfully