Starting /dee2/code/volunteer_pipeline.sh SRR6322359 current disk space = 1543935991808 free memory = 1601090972 SRR6322359 SRAfilesize b060d551fa38ef53adb7a7eae776b273 SRR6322359.sra SRR6322359.sra file validated SRR6322359 is single end SRR6322359 is conventional basespace SRR6322359 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.61575 34.0 33.0 34.0 25.0 34.0 2 32.6585 34.0 33.0 34.0 28.0 34.0 3 32.7445 34.0 33.0 34.0 30.0 34.0 4 32.94 34.0 33.0 34.0 32.0 34.0 5 33.0705 34.0 33.0 34.0 32.0 34.0 6 36.93275 38.0 38.0 38.0 35.0 38.0 7 37.15625 38.0 38.0 38.0 36.0 38.0 8 37.32025 38.0 38.0 38.0 37.0 38.0 9 37.32725 38.0 38.0 38.0 37.0 38.0 10 37.33225 38.0 38.0 38.0 37.0 38.0 11 37.36175 38.0 38.0 38.0 37.0 38.0 12 37.34075 38.0 38.0 38.0 37.0 38.0 13 37.31875 38.0 38.0 38.0 37.0 38.0 14 37.2645 38.0 38.0 38.0 37.0 38.0 15 37.25125 38.0 38.0 38.0 37.0 38.0 16 37.31575 38.0 38.0 38.0 37.0 38.0 17 37.295 38.0 38.0 38.0 37.0 38.0 18 37.33625 38.0 38.0 38.0 37.0 38.0 19 37.2985 38.0 38.0 38.0 37.0 38.0 20 37.2315 38.0 38.0 38.0 37.0 38.0 21 37.204 38.0 38.0 38.0 37.0 38.0 22 37.21425 38.0 38.0 38.0 37.0 38.0 23 37.24575 38.0 38.0 38.0 37.0 38.0 24 37.27175 38.0 38.0 38.0 37.0 38.0 25 37.32825 38.0 38.0 38.0 37.0 38.0 26 37.211 38.0 38.0 38.0 37.0 38.0 27 37.22925 38.0 38.0 38.0 37.0 38.0 28 37.22975 38.0 38.0 38.0 37.0 38.0 29 37.25025 38.0 38.0 38.0 37.0 38.0 30 37.17125 38.0 38.0 38.0 37.0 38.0 31 37.20325 38.0 38.0 38.0 37.0 38.0 32 37.28975 38.0 38.0 38.0 37.0 38.0 33 37.2135 38.0 38.0 38.0 37.0 38.0 34 37.21925 38.0 38.0 38.0 37.0 38.0 35 37.28075 38.0 38.0 38.0 37.0 38.0 36 37.24125 38.0 38.0 38.0 37.0 38.0 37 37.2475 38.0 38.0 38.0 37.0 38.0 38 37.24775 38.0 38.0 38.0 37.0 38.0 39 37.244 38.0 38.0 38.0 37.0 38.0 40 37.2285 38.0 38.0 38.0 37.0 38.0 41 37.2035 38.0 38.0 38.0 37.0 38.0 42 37.23975 38.0 38.0 38.0 37.0 38.0 43 37.28075 38.0 38.0 38.0 37.0 38.0 44 37.2345 38.0 38.0 38.0 37.0 38.0 45 37.19175 38.0 38.0 38.0 37.0 38.0 46 37.19675 38.0 38.0 38.0 37.0 38.0 47 37.18 38.0 38.0 38.0 37.0 38.0 48 37.14725 38.0 38.0 38.0 37.0 38.0 49 37.0895 38.0 38.0 38.0 37.0 38.0 50 37.07925 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 3.0 24 6.0 25 7.0 26 5.0 27 7.0 28 24.0 29 22.0 30 41.0 31 32.0 32 47.0 33 60.0 34 88.0 35 173.0 36 582.0 37 2894.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.85345997286296 9.959294436906378 8.738127544097694 37.44911804613297 2 23.875 9.925 32.775 33.425 3 21.125 14.099999999999998 25.525 39.25 4 26.200000000000003 18.45 23.849999999999998 31.5 5 26.325 24.775 26.1 22.8 6 24.65 29.299999999999997 22.8 23.25 7 19.25 24.425 36.199999999999996 20.125 8 21.05 24.6 29.15 25.2 9 19.25 22.8 33.275 24.675 10 20.375 32.25 26.5 20.875 11 25.2 25.575 24.224999999999998 25.0 12 24.224999999999998 23.474999999999998 25.924999999999997 26.375 13 22.625 24.775 26.125 26.474999999999998 14 22.575 26.200000000000003 26.650000000000002 24.575 15 23.3 25.324999999999996 26.450000000000003 24.925 16 23.724999999999998 24.85 25.900000000000002 25.525 17 23.150000000000002 25.624999999999996 24.85 26.375 18 24.2 24.474999999999998 26.35 24.975 19 23.799999999999997 26.474999999999998 24.125 25.6 20 23.474999999999998 25.224999999999998 25.6 25.7 21 23.575 26.224999999999998 25.55 24.65 22 24.325 25.8 24.15 25.724999999999998 23 22.3 25.474999999999998 26.375 25.85 24 22.2 25.825 26.05 25.924999999999997 25 22.325 25.8 24.775 27.1 26 22.900000000000002 25.174999999999997 26.150000000000002 25.775 27 23.35 24.6 25.874999999999996 26.174999999999997 28 22.95 24.675 24.95 27.425 29 24.575 25.624999999999996 24.4 25.4 30 22.875 24.825 26.625 25.674999999999997 31 24.425 25.275 23.9 26.400000000000002 32 22.55 26.200000000000003 25.974999999999998 25.275 33 23.325000000000003 26.224999999999998 24.675 25.775 34 24.425 25.674999999999997 24.6 25.3 35 24.025 26.900000000000002 24.275 24.8 36 24.075 25.575 24.5 25.85 37 23.875 25.5 24.375 26.25 38 23.9 24.375 25.924999999999997 25.8 39 23.95 24.625 25.525 25.900000000000002 40 23.525 25.674999999999997 24.375 26.424999999999997 41 24.325 26.1 24.8 24.775 42 23.775 25.374999999999996 24.5 26.35 43 23.9 24.975 25.575 25.55 44 23.45 25.924999999999997 25.4 25.224999999999998 45 23.35 24.7 25.85 26.1 46 22.55 25.2 24.474999999999998 27.775 47 22.675 26.85 25.275 25.2 48 22.975 25.674999999999997 24.85 26.5 49 24.125 25.7 25.124999999999996 25.05 50 24.05 25.650000000000002 24.95 25.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 2.0 24 2.0 25 6.5 26 11.0 27 15.5 28 20.0 29 25.5 30 31.0 31 37.5 32 44.0 33 57.5 34 71.0 35 92.5 36 114.0 37 143.0 38 172.0 39 201.5 40 231.0 41 254.5 42 278.0 43 312.5 44 347.0 45 341.5 46 336.0 47 331.0 48 326.0 49 338.0 50 350.0 51 312.0 52 274.0 53 266.5 54 259.0 55 255.5 56 252.0 57 223.0 58 194.0 59 175.5 60 157.0 61 143.5 62 130.0 63 119.5 64 109.0 65 96.5 66 84.0 67 74.0 68 64.0 69 56.0 70 48.0 71 40.5 72 33.0 73 28.5 74 24.0 75 22.0 76 20.0 77 14.5 78 9.0 79 5.5 80 2.0 81 2.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982505 spots for SRR6322359.sra Written 982505 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra Read 982493 spots for SRR6322359.sra Written 982493 spots for SRR6322359.sra SRR ids: ['SRR6322359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yf9o_6qd SRR6322359.sra spots: 19649872 blocks: [[1, 982493], [982494, 1964986], [1964987, 2947479], [2947480, 3929972], [3929973, 4912465], [4912466, 5894958], [5894959, 6877451], [6877452, 7859944], [7859945, 8842437], [8842438, 9824930], [9824931, 10807423], [10807424, 11789916], [11789917, 12772409], [12772410, 13754902], [13754903, 14737395], [14737396, 15719888], [15719889, 16702381], [16702382, 17684874], [17684875, 18667367], [18667368, 19649872]] SRR6322359 file size 3414248 SRR6322359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322359 SRR6322359_1.fastq Input file: SRR6322359_1.fastq trimmed: SRR6322359-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:46:56 2024 >> started Sat Dec 7 09:47:09 2024 >> done (13.105s) 19649872 reads processed; of these: 3422 ( 0.02%) short reads filtered out after trimming by size control 8187 ( 0.04%) empty reads filtered out after trimming by size control 19638263 (99.94%) reads available; of these: 125037 ( 0.64%) trimmed reads available after processing 19513226 (99.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 183 0.00% 19 240 0.00% 20 268 0.00% 21 297 0.00% 22 302 0.00% 23 453 0.00% 24 990 0.01% 25 743 0.00% 26 610 0.00% 27 542 0.00% 28 578 0.00% 29 544 0.00% 30 637 0.00% 31 682 0.00% 32 769 0.00% 33 824 0.00% 34 896 0.00% 35 995 0.01% 36 1129 0.01% 37 1353 0.01% 38 1513 0.01% 39 1837 0.01% 40 2161 0.01% 41 2590 0.01% 42 3497 0.02% 43 4233 0.02% 44 5444 0.03% 45 7420 0.04% 46 10157 0.05% 47 14712 0.07% 48 23628 0.12% 49 34810 0.18% 50 19513226 99.36% 19638263 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=19 prefix-density=0.43 prefix-fanout=1.9 sequence=GGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=19 fanout-score=72.34 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.9 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 09:47:20 Started mapping on | Dec 07 09:47:21 Finished on | Dec 07 09:47:39 Mapping speed, Million of reads per hour | 3927.65 Number of input reads | 19638263 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18610303 Uniquely mapped reads % | 94.77% Average mapped length | 49.78 Number of splices: Total | 2892725 Number of splices: Annotated (sjdb) | 2781911 Number of splices: GT/AG | 2857067 Number of splices: GC/AG | 28892 Number of splices: AT/AC | 2099 Number of splices: Non-canonical | 4667 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510930 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 434919 % of reads mapped to too many loci | 2.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 517030 517030 517030 N_multimapping 510930 510930 510930 N_noFeature 794306 18109029 892754 N_ambiguous 437320 1218 34904 UnstrandedReadsAssigned:17378677 PositiveStrandReadsAssigned:500056 NegativeStrandReadsAssigned:17682645 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322359 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322359-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,638,263 reads, 17,381,932 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR6322359.ke.tsv 35125 SRR6322359.se.tsv 88098 total ==> SRR6322359.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.14864e-05 1.32404e-06 PNS24247 1044 945 58.786 6.00185 PNS24249 1928 1829 3.74627 0.197619 PNS24246 1044 945 58.786 6.00185 PNS24248 1044 945 58.786 6.00185 PNS24244 1471 1372 87.8957 6.18097 PNS24243 293 194 0 0 KQK14069 1603 1504 792.894 50.864 KQK14071 474 375 111.202 28.6104 ==> SRR6322359.se.tsv <== BRADI_1g14170v3 1053 BRADI_1g53295v3 185 BRADI_1g59795v3 461 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 4665 BRADI_1g74790v3 36 BRADI_1g09890v3 0 BRADI_1g77505v3 435 BRADI_1g48960v3 0 SRR6322359 completed mapping pipeline successfully