Starting /dee2/code/volunteer_pipeline.sh SRR6322360 current disk space = 1543973781504 free memory = 1451634976 SRR6322360 SRAfilesize 45aed98ba924baee2df94a47071c7b05 SRR6322360.sra SRR6322360.sra file validated SRR6322360 is single end SRR6322360 is conventional basespace SRR6322360 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.95 34.0 33.0 34.0 27.0 34.0 2 32.744 34.0 33.0 34.0 28.0 34.0 3 32.88675 34.0 33.0 34.0 32.0 34.0 4 33.044 34.0 33.0 34.0 32.0 34.0 5 33.035 34.0 33.0 34.0 32.0 34.0 6 36.92175 38.0 38.0 38.0 35.0 38.0 7 37.205 38.0 38.0 38.0 36.0 38.0 8 37.238 38.0 38.0 38.0 37.0 38.0 9 37.28125 38.0 38.0 38.0 37.0 38.0 10 37.26975 38.0 38.0 38.0 37.0 38.0 11 37.26225 38.0 38.0 38.0 37.0 38.0 12 37.3655 38.0 38.0 38.0 37.0 38.0 13 37.25075 38.0 38.0 38.0 37.0 38.0 14 37.296 38.0 38.0 38.0 37.0 38.0 15 37.33025 38.0 38.0 38.0 37.0 38.0 16 37.3465 38.0 38.0 38.0 37.0 38.0 17 37.26225 38.0 38.0 38.0 37.0 38.0 18 37.29 38.0 38.0 38.0 37.0 38.0 19 37.26 38.0 38.0 38.0 37.0 38.0 20 37.29375 38.0 38.0 38.0 37.0 38.0 21 37.3165 38.0 38.0 38.0 37.0 38.0 22 37.22675 38.0 38.0 38.0 37.0 38.0 23 37.3315 38.0 38.0 38.0 37.0 38.0 24 37.31125 38.0 38.0 38.0 37.0 38.0 25 37.297 38.0 38.0 38.0 37.0 38.0 26 37.25125 38.0 38.0 38.0 37.0 38.0 27 37.2435 38.0 38.0 38.0 37.0 38.0 28 37.20025 38.0 38.0 38.0 37.0 38.0 29 37.21375 38.0 38.0 38.0 37.0 38.0 30 37.2135 38.0 38.0 38.0 37.0 38.0 31 37.2355 38.0 38.0 38.0 37.0 38.0 32 37.21975 38.0 38.0 38.0 37.0 38.0 33 37.1995 38.0 38.0 38.0 37.0 38.0 34 37.09875 38.0 38.0 38.0 36.0 38.0 35 37.157 38.0 38.0 38.0 37.0 38.0 36 37.1325 38.0 38.0 38.0 37.0 38.0 37 37.18125 38.0 38.0 38.0 37.0 38.0 38 37.19925 38.0 38.0 38.0 37.0 38.0 39 37.15275 38.0 38.0 38.0 37.0 38.0 40 37.192 38.0 38.0 38.0 37.0 38.0 41 37.141 38.0 38.0 38.0 37.0 38.0 42 37.14 38.0 38.0 38.0 37.0 38.0 43 37.23925 38.0 38.0 38.0 37.0 38.0 44 37.251 38.0 38.0 38.0 37.0 38.0 45 37.2335 38.0 38.0 38.0 37.0 38.0 46 37.215 38.0 38.0 38.0 37.0 38.0 47 37.21975 38.0 38.0 38.0 37.0 38.0 48 37.2015 38.0 38.0 38.0 37.0 38.0 49 37.1365 38.0 38.0 38.0 37.0 38.0 50 37.07925 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 4.0 24 3.0 25 8.0 26 9.0 27 15.0 28 18.0 29 32.0 30 14.0 31 39.0 32 50.0 33 61.0 34 105.0 35 163.0 36 539.0 37 2932.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.96373892022562 8.756379264034381 7.467096427612141 38.81278538812785 2 22.650000000000002 10.025 36.525 30.8 3 18.825 14.099999999999998 25.874999999999996 41.199999999999996 4 24.675 19.725 23.7 31.900000000000002 5 25.825 27.650000000000002 23.425 23.1 6 22.95 30.925000000000004 24.349999999999998 21.775 7 19.3 24.0 38.5 18.2 8 21.099999999999998 24.775 30.2 23.925 9 19.475 22.35 33.900000000000006 24.275 10 20.775 33.625 26.650000000000002 18.95 11 24.3 27.474999999999998 22.475 25.75 12 23.875 23.1 26.424999999999997 26.6 13 23.175 25.525 25.6 25.7 14 22.275 24.55 27.775 25.4 15 23.549999999999997 24.325 25.924999999999997 26.200000000000003 16 24.224999999999998 25.05 25.7 25.025 17 22.925 25.874999999999996 25.825 25.374999999999996 18 22.5 26.375 26.424999999999997 24.7 19 22.5 27.325 24.975 25.2 20 22.325 25.424999999999997 26.950000000000003 25.3 21 21.075 27.075 26.200000000000003 25.650000000000002 22 24.275 25.8 25.05 24.875 23 22.35 25.650000000000002 26.125 25.874999999999996 24 21.45 25.174999999999997 27.775 25.6 25 23.0 26.125 25.8 25.074999999999996 26 22.95 27.224999999999998 25.025 24.8 27 21.825 25.825 25.825 26.525 28 23.200000000000003 25.624999999999996 25.575 25.6 29 23.75 25.75 25.174999999999997 25.324999999999996 30 22.15 25.3 26.825 25.724999999999998 31 22.25 25.45 27.35 24.95 32 22.85 26.424999999999997 26.25 24.474999999999998 33 22.6 25.3 27.05 25.05 34 24.0 24.925 24.9 26.174999999999997 35 23.474999999999998 26.55 25.3 24.675 36 22.85 25.525 25.05 26.575 37 22.625 26.700000000000003 25.474999999999998 25.2 38 22.8 26.35 26.0 24.85 39 22.625 24.275 26.275 26.825 40 21.85 25.15 26.200000000000003 26.8 41 22.225 25.674999999999997 26.575 25.525 42 22.475 25.3 25.85 26.375 43 22.5 25.674999999999997 25.324999999999996 26.5 44 22.85 26.075 26.075 25.0 45 23.150000000000002 25.0 26.150000000000002 25.7 46 22.175 24.725 27.075 26.025 47 23.375 25.8 26.875 23.95 48 24.275 25.924999999999997 25.5 24.3 49 23.1 25.95 25.724999999999998 25.224999999999998 50 22.5 25.074999999999996 26.174999999999997 26.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 3.5 22 5.0 23 6.0 24 7.0 25 11.0 26 15.0 27 14.0 28 13.0 29 22.0 30 31.0 31 38.0 32 45.0 33 60.5 34 76.0 35 110.5 36 145.0 37 164.0 38 183.0 39 207.0 40 231.0 41 278.5 42 326.0 43 349.0 44 372.0 45 359.0 46 346.0 47 357.0 48 368.0 49 347.5 50 327.0 51 307.0 52 287.0 53 275.0 54 263.0 55 234.5 56 206.0 57 196.0 58 186.0 59 161.5 60 137.0 61 132.0 62 127.0 63 108.0 64 89.0 65 73.5 66 58.0 67 52.0 68 46.0 69 43.0 70 40.0 71 34.0 72 28.0 73 24.0 74 20.0 75 16.0 76 12.0 77 7.5 78 3.0 79 3.0 80 3.0 81 1.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.925000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891832 spots for SRR6322360.sra Written 891832 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra Read 891828 spots for SRR6322360.sra Written 891828 spots for SRR6322360.sra SRR ids: ['SRR6322360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kyxccd38 SRR6322360.sra spots: 17836564 blocks: [[1, 891828], [891829, 1783656], [1783657, 2675484], [2675485, 3567312], [3567313, 4459140], [4459141, 5350968], [5350969, 6242796], [6242797, 7134624], [7134625, 8026452], [8026453, 8918280], [8918281, 9810108], [9810109, 10701936], [10701937, 11593764], [11593765, 12485592], [12485593, 13377420], [13377421, 14269248], [14269249, 15161076], [15161077, 16052904], [16052905, 16944732], [16944733, 17836564]] SRR6322360 file size 3098183 SRR6322360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322360 SRR6322360_1.fastq Input file: SRR6322360_1.fastq trimmed: SRR6322360-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:48:34 2024 >> started Sat Dec 7 09:49:19 2024 >> done (44.486s) 17836564 reads processed; of these: 3705 ( 0.02%) short reads filtered out after trimming by size control 7824 ( 0.04%) empty reads filtered out after trimming by size control 17825035 (99.94%) reads available; of these: 112781 ( 0.63%) trimmed reads available after processing 17712254 (99.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 214 0.00% 19 258 0.00% 20 312 0.00% 21 364 0.00% 22 393 0.00% 23 560 0.00% 24 975 0.01% 25 697 0.00% 26 570 0.00% 27 568 0.00% 28 566 0.00% 29 641 0.00% 30 605 0.00% 31 717 0.00% 32 764 0.00% 33 792 0.00% 34 885 0.00% 35 953 0.01% 36 1119 0.01% 37 1235 0.01% 38 1395 0.01% 39 1713 0.01% 40 2118 0.01% 41 2502 0.01% 42 3018 0.02% 43 3960 0.02% 44 5130 0.03% 45 6607 0.04% 46 9162 0.05% 47 13299 0.07% 48 20484 0.11% 49 30205 0.17% 50 17712254 99.37% 17825035 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=29 prefix-density=0.39 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=51.92 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.9 sequence=AGCAGCAGCAACAACAGGCGTTGCGGGGGCCCAGAGGATGCTGTCCCGAACAATGAAGTGGCAAAGCGGGGCGTCACCAGGCTTGATGTGCGCCGGCATCTTCCTTGGGTTGAAGTTTGACGTGTCGAGGTGGCACACAGCGAGTACCTCCATCCTGTCCGGTCCTCCACTGCTGCCAAGGTCCTCCTTCTCCAGC Started job on | Dec 07 09:50:33 Started mapping on | Dec 07 09:50:34 Finished on | Dec 07 09:53:06 Mapping speed, Million of reads per hour | 422.17 Number of input reads | 17825035 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16835363 Uniquely mapped reads % | 94.45% Average mapped length | 49.79 Number of splices: Total | 2616967 Number of splices: Annotated (sjdb) | 2523531 Number of splices: GT/AG | 2585020 Number of splices: GC/AG | 25840 Number of splices: AT/AC | 1717 Number of splices: Non-canonical | 4390 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470676 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 440290 % of reads mapped to too many loci | 2.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518996 518996 518996 N_multimapping 470676 470676 470676 N_noFeature 799685 16239497 887438 N_ambiguous 538179 1119 30627 UnstrandedReadsAssigned:15497499 PositiveStrandReadsAssigned:594747 NegativeStrandReadsAssigned:15917298 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322360 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322360-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,825,035 reads, 15,684,340 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR6322360.ke.tsv 35125 SRR6322360.se.tsv 88098 total ==> SRR6322360.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 67.8142 7.97676 PNS24249 1928 1829 0 0 PNS24246 1044 945 67.8142 7.97676 PNS24248 1044 945 67.8142 7.97676 PNS24244 1471 1372 58.5573 4.74422 PNS24243 293 194 0 0 KQK14069 1603 1504 526.745 38.9305 KQK14071 474 375 0 0 ==> SRR6322360.se.tsv <== BRADI_1g14170v3 667 BRADI_1g53295v3 115 BRADI_1g59795v3 376 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 5870 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 386 BRADI_1g48960v3 0 SRR6322360 completed mapping pipeline successfully