Starting /dee2/code/volunteer_pipeline.sh SRR6322361 current disk space = 1543984402432 free memory = 1602501976 SRR6322361 SRAfilesize 5597ac3bdf41231cc484fa2ca3d227aa SRR6322361.sra SRR6322361.sra file validated SRR6322361 is single end SRR6322361 is conventional basespace SRR6322361 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.322 34.0 33.0 34.0 28.0 34.0 2 32.6495 34.0 33.0 34.0 30.0 34.0 3 32.805 34.0 33.0 34.0 32.0 34.0 4 32.83175 34.0 33.0 34.0 32.0 34.0 5 32.868 34.0 33.0 34.0 32.0 34.0 6 36.72375 38.0 37.0 38.0 34.0 38.0 7 36.9735 38.0 38.0 38.0 36.0 38.0 8 37.18575 38.0 38.0 38.0 36.0 38.0 9 37.14225 38.0 38.0 38.0 37.0 38.0 10 37.1565 38.0 38.0 38.0 36.0 38.0 11 37.231 38.0 38.0 38.0 37.0 38.0 12 37.14825 38.0 38.0 38.0 37.0 38.0 13 37.1625 38.0 38.0 38.0 37.0 38.0 14 37.2135 38.0 38.0 38.0 37.0 38.0 15 37.15575 38.0 38.0 38.0 36.0 38.0 16 37.11525 38.0 38.0 38.0 36.0 38.0 17 37.1265 38.0 38.0 38.0 36.0 38.0 18 37.1385 38.0 38.0 38.0 37.0 38.0 19 37.12 38.0 38.0 38.0 36.0 38.0 20 37.16625 38.0 38.0 38.0 37.0 38.0 21 37.1435 38.0 38.0 38.0 36.0 38.0 22 37.12725 38.0 38.0 38.0 37.0 38.0 23 37.0815 38.0 38.0 38.0 36.0 38.0 24 37.1425 38.0 38.0 38.0 36.0 38.0 25 37.1705 38.0 38.0 38.0 36.0 38.0 26 37.14825 38.0 38.0 38.0 36.0 38.0 27 37.159 38.0 38.0 38.0 36.0 38.0 28 37.0625 38.0 38.0 38.0 36.0 38.0 29 37.10175 38.0 38.0 38.0 36.0 38.0 30 37.09325 38.0 38.0 38.0 37.0 38.0 31 37.128 38.0 38.0 38.0 36.0 38.0 32 37.1505 38.0 38.0 38.0 37.0 38.0 33 37.01025 38.0 38.0 38.0 36.0 38.0 34 36.98075 38.0 38.0 38.0 36.0 38.0 35 37.069 38.0 38.0 38.0 36.0 38.0 36 37.05625 38.0 38.0 38.0 36.0 38.0 37 37.0665 38.0 38.0 38.0 36.0 38.0 38 37.105 38.0 38.0 38.0 36.0 38.0 39 37.038 38.0 38.0 38.0 36.0 38.0 40 37.06725 38.0 38.0 38.0 36.0 38.0 41 37.0795 38.0 38.0 38.0 36.0 38.0 42 37.032 38.0 38.0 38.0 36.0 38.0 43 37.0375 38.0 38.0 38.0 36.0 38.0 44 36.9785 38.0 38.0 38.0 36.0 38.0 45 37.084 38.0 38.0 38.0 36.0 38.0 46 37.07525 38.0 38.0 38.0 36.0 38.0 47 37.0625 38.0 38.0 38.0 36.0 38.0 48 36.988 38.0 38.0 38.0 36.0 38.0 49 36.94275 38.0 38.0 38.0 36.0 38.0 50 36.8975 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 4.0 23 1.0 24 6.0 25 8.0 26 12.0 27 19.0 28 26.0 29 30.0 30 38.0 31 38.0 32 61.0 33 90.0 34 105.0 35 160.0 36 538.0 37 2858.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.31406044678055 10.538764783180026 8.646517739816032 39.500657030223394 2 25.1 10.274999999999999 32.324999999999996 32.300000000000004 3 21.25 12.0 26.075 40.675 4 25.974999999999998 17.775 21.425 34.825 5 27.700000000000003 22.6 24.25 25.45 6 25.525 27.150000000000002 23.425 23.9 7 21.675 24.375 34.4 19.55 8 21.05 25.374999999999996 30.25 23.325000000000003 9 21.224999999999998 23.0 31.7 24.075 10 20.724999999999998 33.0 26.950000000000003 19.325 11 26.125 25.15 23.925 24.8 12 24.0 22.125 27.35 26.525 13 23.549999999999997 24.525 26.424999999999997 25.5 14 23.025000000000002 25.424999999999997 26.674999999999997 24.875 15 23.275000000000002 25.650000000000002 25.624999999999996 25.45 16 24.224999999999998 24.2 25.724999999999998 25.85 17 23.925 25.4 25.5 25.174999999999997 18 23.525 24.925 26.474999999999998 25.074999999999996 19 23.724999999999998 25.650000000000002 25.2 25.424999999999997 20 23.9 24.975 25.724999999999998 25.4 21 23.5 24.224999999999998 26.400000000000002 25.874999999999996 22 23.45 25.874999999999996 24.875 25.8 23 22.025 25.025 27.075 25.874999999999996 24 22.325 24.6 25.1 27.975 25 22.875 24.6 25.924999999999997 26.6 26 23.7 24.825 26.275 25.2 27 22.45 25.6 25.874999999999996 26.075 28 23.200000000000003 24.425 26.0 26.375 29 23.549999999999997 25.2 26.450000000000003 24.8 30 22.525000000000002 24.325 25.374999999999996 27.775 31 24.3 24.474999999999998 25.174999999999997 26.05 32 23.875 24.575 26.424999999999997 25.124999999999996 33 22.25 25.775 25.5 26.474999999999998 34 23.075000000000003 25.4 25.224999999999998 26.3 35 24.875 24.6 25.5 25.025 36 23.35 25.25 24.55 26.85 37 24.775 24.275 24.65 26.3 38 23.025000000000002 24.375 26.05 26.55 39 22.6 25.575 25.374999999999996 26.450000000000003 40 25.124999999999996 25.224999999999998 24.65 25.0 41 24.325 25.1 25.825 24.75 42 22.75 24.9 25.275 27.075 43 23.599999999999998 25.6 24.675 26.125 44 24.775 24.675 26.125 24.425 45 23.549999999999997 24.95 25.05 26.450000000000003 46 24.125 25.074999999999996 24.5 26.3 47 24.15 25.724999999999998 24.65 25.474999999999998 48 23.775 24.3 26.724999999999998 25.2 49 22.175 24.825 25.224999999999998 27.775 50 23.45 25.424999999999997 26.1 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 6.0 26 8.0 27 10.0 28 12.0 29 14.5 30 17.0 31 28.5 32 40.0 33 53.0 34 66.0 35 98.5 36 131.0 37 152.5 38 174.0 39 202.0 40 230.0 41 253.5 42 277.0 43 283.0 44 289.0 45 306.5 46 324.0 47 337.0 48 350.0 49 349.5 50 349.0 51 326.5 52 304.0 53 284.0 54 264.0 55 257.0 56 250.0 57 220.5 58 191.0 59 179.5 60 168.0 61 153.5 62 139.0 63 123.0 64 107.0 65 95.0 66 83.0 67 72.0 68 61.0 69 57.5 70 54.0 71 52.0 72 50.0 73 35.5 74 21.0 75 20.5 76 20.0 77 15.0 78 10.0 79 7.0 80 4.0 81 2.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983294 spots for SRR6322361.sra Written 983294 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra Read 983290 spots for SRR6322361.sra Written 983290 spots for SRR6322361.sra SRR ids: ['SRR6322361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4x5vq3t2 SRR6322361.sra spots: 19665804 blocks: [[1, 983290], [983291, 1966580], [1966581, 2949870], [2949871, 3933160], [3933161, 4916450], [4916451, 5899740], [5899741, 6883030], [6883031, 7866320], [7866321, 8849610], [8849611, 9832900], [9832901, 10816190], [10816191, 11799480], [11799481, 12782770], [12782771, 13766060], [13766061, 14749350], [14749351, 15732640], [15732641, 16715930], [16715931, 17699220], [17699221, 18682510], [18682511, 19665804]] SRR6322361 file size 3416991 SRR6322361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322361 SRR6322361_1.fastq Input file: SRR6322361_1.fastq trimmed: SRR6322361-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:49:00 2024 >> started Sat Dec 7 09:49:14 2024 >> done (14.123s) 19665804 reads processed; of these: 3244 ( 0.02%) short reads filtered out after trimming by size control 8649 ( 0.04%) empty reads filtered out after trimming by size control 19653911 (99.94%) reads available; of these: 134769 ( 0.69%) trimmed reads available after processing 19519142 (99.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 200 0.00% 19 189 0.00% 20 262 0.00% 21 245 0.00% 22 292 0.00% 23 692 0.00% 24 532 0.00% 25 511 0.00% 26 640 0.00% 27 529 0.00% 28 527 0.00% 29 570 0.00% 30 578 0.00% 31 666 0.00% 32 752 0.00% 33 764 0.00% 34 903 0.00% 35 996 0.01% 36 1124 0.01% 37 1357 0.01% 38 1635 0.01% 39 1970 0.01% 40 2308 0.01% 41 2891 0.01% 42 3707 0.02% 43 4751 0.02% 44 6003 0.03% 45 8033 0.04% 46 11021 0.06% 47 16202 0.08% 48 25674 0.13% 49 38245 0.19% 50 19519142 99.31% 19653911 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=17 fanout-score=69.88 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.2 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 09:49:24 Started mapping on | Dec 07 09:49:24 Finished on | Dec 07 09:49:45 Mapping speed, Million of reads per hour | 3369.24 Number of input reads | 19653911 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18563902 Uniquely mapped reads % | 94.45% Average mapped length | 49.77 Number of splices: Total | 2923865 Number of splices: Annotated (sjdb) | 2813098 Number of splices: GT/AG | 2888815 Number of splices: GC/AG | 28463 Number of splices: AT/AC | 2030 Number of splices: Non-canonical | 4557 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 498037 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 510196 % of reads mapped to too many loci | 2.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 591972 591972 591972 N_multimapping 498037 498037 498037 N_noFeature 760089 18046088 858075 N_ambiguous 454623 1244 35364 UnstrandedReadsAssigned:17349190 PositiveStrandReadsAssigned:516570 NegativeStrandReadsAssigned:17670463 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322361 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322361-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,653,911 reads, 17,377,248 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6322361.ke.tsv 35125 SRR6322361.se.tsv 88098 total ==> SRR6322361.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00333666 0.000385435 PNS24247 1044 945 48.1845 4.92991 PNS24249 1928 1829 3.2346 0.17099 PNS24246 1044 945 48.1845 4.92991 PNS24248 1044 945 48.1845 4.92991 PNS24244 1471 1372 101.209 7.13226 PNS24243 293 194 0 0 KQK14069 1603 1504 1255.09 80.6848 KQK14071 474 375 166.598 42.9538 ==> SRR6322361.se.tsv <== BRADI_1g14170v3 1609 BRADI_1g53295v3 147 BRADI_1g59795v3 409 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 5351 BRADI_1g74790v3 18 BRADI_1g09890v3 0 BRADI_1g77505v3 358 BRADI_1g48960v3 0 SRR6322361 completed mapping pipeline successfully