Starting /dee2/code/volunteer_pipeline.sh SRR6322362 current disk space = 1544013393920 free memory = 1598690108 SRR6322362 SRAfilesize 69864415ea699a30021776e5731287f4 SRR6322362.sra SRR6322362.sra file validated SRR6322362 is single end SRR6322362 is conventional basespace SRR6322362 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322362_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72575 34.0 33.0 34.0 32.0 34.0 2 32.7665 34.0 33.0 34.0 31.0 34.0 3 32.91075 34.0 33.0 34.0 32.0 34.0 4 32.93 34.0 33.0 34.0 32.0 34.0 5 32.98125 34.0 33.0 34.0 32.0 34.0 6 36.77 38.0 38.0 38.0 35.0 38.0 7 37.163 38.0 38.0 38.0 36.0 38.0 8 37.145 38.0 38.0 38.0 36.0 38.0 9 37.23925 38.0 38.0 38.0 37.0 38.0 10 37.328 38.0 38.0 38.0 37.0 38.0 11 37.36 38.0 38.0 38.0 37.0 38.0 12 37.2545 38.0 38.0 38.0 37.0 38.0 13 37.22475 38.0 38.0 38.0 37.0 38.0 14 37.29675 38.0 38.0 38.0 37.0 38.0 15 37.26275 38.0 38.0 38.0 37.0 38.0 16 37.21575 38.0 38.0 38.0 37.0 38.0 17 37.23675 38.0 38.0 38.0 37.0 38.0 18 37.28 38.0 38.0 38.0 37.0 38.0 19 37.3035 38.0 38.0 38.0 37.0 38.0 20 37.323 38.0 38.0 38.0 37.0 38.0 21 37.218 38.0 38.0 38.0 37.0 38.0 22 37.316 38.0 38.0 38.0 37.0 38.0 23 37.3035 38.0 38.0 38.0 37.0 38.0 24 37.18425 38.0 38.0 38.0 37.0 38.0 25 37.2475 38.0 38.0 38.0 37.0 38.0 26 37.193 38.0 38.0 38.0 37.0 38.0 27 37.24625 38.0 38.0 38.0 37.0 38.0 28 37.2655 38.0 38.0 38.0 37.0 38.0 29 37.25725 38.0 38.0 38.0 37.0 38.0 30 37.228 38.0 38.0 38.0 37.0 38.0 31 37.267 38.0 38.0 38.0 37.0 38.0 32 37.26675 38.0 38.0 38.0 37.0 38.0 33 37.2225 38.0 38.0 38.0 37.0 38.0 34 37.14575 38.0 38.0 38.0 37.0 38.0 35 37.1375 38.0 38.0 38.0 36.0 38.0 36 37.16325 38.0 38.0 38.0 36.0 38.0 37 37.2605 38.0 38.0 38.0 37.0 38.0 38 37.1605 38.0 38.0 38.0 36.0 38.0 39 37.17 38.0 38.0 38.0 37.0 38.0 40 37.24425 38.0 38.0 38.0 37.0 38.0 41 37.27875 38.0 38.0 38.0 37.0 38.0 42 37.1645 38.0 38.0 38.0 36.0 38.0 43 37.21875 38.0 38.0 38.0 37.0 38.0 44 37.18675 38.0 38.0 38.0 37.0 38.0 45 37.2235 38.0 38.0 38.0 37.0 38.0 46 37.272 38.0 38.0 38.0 37.0 38.0 47 37.16925 38.0 38.0 38.0 36.0 38.0 48 37.16425 38.0 38.0 38.0 37.0 38.0 49 37.14425 38.0 38.0 38.0 37.0 38.0 50 37.03675 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 2.0 25 3.0 26 10.0 27 9.0 28 17.0 29 26.0 30 38.0 31 39.0 32 54.0 33 93.0 34 109.0 35 161.0 36 483.0 37 2951.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.49934776937125 10.383511609705192 9.574745630054787 37.54239499086877 2 23.05 11.200000000000001 33.35 32.4 3 21.10527631907977 14.603650912728183 25.18129532383096 39.109777444361086 4 26.900000000000002 19.6 21.95 31.55 5 26.400000000000002 24.65 25.15 23.799999999999997 6 25.825 27.825 23.1 23.25 7 20.175 25.2 34.5 20.125 8 20.65 24.224999999999998 29.45 25.674999999999997 9 21.4 22.6 32.475 23.525 10 22.625 31.5 26.224999999999998 19.650000000000002 11 25.2 25.1 23.3 26.400000000000002 12 25.05 21.425 25.85 27.675 13 23.5 23.5 27.700000000000003 25.3 14 24.175 24.075 26.275 25.474999999999998 15 23.799999999999997 23.575 25.85 26.775 16 23.625 24.0 25.3 27.075 17 22.6 25.224999999999998 25.624999999999996 26.55 18 22.975 25.074999999999996 25.924999999999997 26.025 19 24.7 25.575 24.2 25.525 20 23.9 24.099999999999998 26.174999999999997 25.825 21 23.425 24.325 25.7 26.55 22 23.9 25.525 24.75 25.825 23 23.724999999999998 24.0 25.974999999999998 26.3 24 24.15 23.150000000000002 26.125 26.575 25 23.35 26.25 24.65 25.75 26 22.55 24.675 27.450000000000003 25.324999999999996 27 23.525 25.2 24.625 26.650000000000002 28 24.474999999999998 25.1 24.8 25.624999999999996 29 23.25 26.200000000000003 25.424999999999997 25.124999999999996 30 24.025 24.0 26.974999999999998 25.0 31 23.674999999999997 24.575 24.375 27.375 32 23.200000000000003 25.0 25.650000000000002 26.150000000000002 33 23.525 24.2 26.125 26.150000000000002 34 23.775 24.525 25.025 26.674999999999997 35 23.45 25.624999999999996 25.474999999999998 25.45 36 24.474999999999998 23.075000000000003 25.324999999999996 27.125 37 24.7 24.25 25.55 25.5 38 23.625 24.675 25.825 25.874999999999996 39 24.0 23.825 26.3 25.874999999999996 40 23.849999999999998 25.25 23.799999999999997 27.1 41 24.3 25.5 24.825 25.374999999999996 42 24.474999999999998 23.9 25.224999999999998 26.400000000000002 43 25.025 24.4 24.825 25.75 44 23.925 24.7 25.924999999999997 25.45 45 23.775 23.849999999999998 25.124999999999996 27.250000000000004 46 24.55 24.575 24.95 25.924999999999997 47 24.775 25.15 24.725 25.35 48 24.5 24.25 24.825 26.424999999999997 49 25.45 26.075 23.05 25.424999999999997 50 24.275 24.875 25.35 25.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 6.0 26 9.0 27 7.5 28 6.0 29 13.0 30 20.0 31 31.0 32 42.0 33 55.5 34 69.0 35 91.0 36 113.0 37 136.5 38 160.0 39 193.0 40 226.0 41 258.0 42 290.0 43 302.0 44 314.0 45 322.0 46 330.0 47 329.5 48 329.0 49 313.0 50 297.0 51 296.5 52 296.0 53 271.5 54 247.0 55 253.5 56 260.0 57 243.0 58 226.0 59 196.0 60 166.0 61 151.5 62 137.0 63 131.0 64 125.0 65 108.5 66 92.0 67 82.5 68 73.0 69 60.0 70 47.0 71 44.5 72 42.0 73 36.0 74 30.0 75 25.0 76 20.0 77 18.0 78 16.0 79 11.0 80 6.0 81 5.0 82 4.0 83 3.5 84 3.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.175 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863438 spots for SRR6322362.sra Written 863438 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra Read 863431 spots for SRR6322362.sra Written 863431 spots for SRR6322362.sra SRR ids: ['SRR6322362.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j7e7rl3f SRR6322362.sra spots: 17268627 blocks: [[1, 863431], [863432, 1726862], [1726863, 2590293], [2590294, 3453724], [3453725, 4317155], [4317156, 5180586], [5180587, 6044017], [6044018, 6907448], [6907449, 7770879], [7770880, 8634310], [8634311, 9497741], [9497742, 10361172], [10361173, 11224603], [11224604, 12088034], [12088035, 12951465], [12951466, 13814896], [13814897, 14678327], [14678328, 15541758], [15541759, 16405189], [16405190, 17268627]] SRR6322362 file size 2999159 SRR6322362 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322362 SRR6322362_1.fastq Input file: SRR6322362_1.fastq trimmed: SRR6322362-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:49:52 2024 >> started Sat Dec 7 09:50:05 2024 >> done (12.726s) 17268627 reads processed; of these: 2282 ( 0.01%) short reads filtered out after trimming by size control 6216 ( 0.04%) empty reads filtered out after trimming by size control 17260129 (99.95%) reads available; of these: 116640 ( 0.68%) trimmed reads available after processing 17143489 (99.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 166 0.00% 19 174 0.00% 20 160 0.00% 21 208 0.00% 22 251 0.00% 23 595 0.00% 24 434 0.00% 25 502 0.00% 26 556 0.00% 27 400 0.00% 28 407 0.00% 29 482 0.00% 30 499 0.00% 31 559 0.00% 32 599 0.00% 33 686 0.00% 34 790 0.00% 35 903 0.01% 36 1038 0.01% 37 1163 0.01% 38 1356 0.01% 39 1670 0.01% 40 2068 0.01% 41 2396 0.01% 42 3164 0.02% 43 4103 0.02% 44 5185 0.03% 45 7010 0.04% 46 9430 0.05% 47 13919 0.08% 48 22456 0.13% 49 33311 0.19% 50 17143489 99.32% 17260129 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.34 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=64.61 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=13.5 sequence=AGCAGCAGCAACAACAGGCGTTGCGGGGGCCCAGAGGATGCTGTCCCGAACAATGAAGTGGCAAAGCGGGGCGTCACCAGGCTTGATGTGCGCCGGCATCTTCCTTGGGTTGAAGTTTGACGTGTCGAGGTGGCACACAGCGAGTACCTCCATCCTGTCCGGTCCTCCACTGCTGCCAAGGTCCTCCTTCTCCAGC Started job on | Dec 07 09:50:15 Started mapping on | Dec 07 09:50:15 Finished on | Dec 07 09:50:31 Mapping speed, Million of reads per hour | 3883.53 Number of input reads | 17260129 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16511105 Uniquely mapped reads % | 95.66% Average mapped length | 49.76 Number of splices: Total | 2533984 Number of splices: Annotated (sjdb) | 2443822 Number of splices: GT/AG | 2503794 Number of splices: GC/AG | 25013 Number of splices: AT/AC | 1492 Number of splices: Non-canonical | 3685 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417269 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 260763 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 331755 331755 331755 N_multimapping 417269 417269 417269 N_noFeature 628659 15973131 726116 N_ambiguous 471124 1129 31026 UnstrandedReadsAssigned:15411322 PositiveStrandReadsAssigned:536845 NegativeStrandReadsAssigned:15753963 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322362 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322362-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,260,129 reads, 15,513,138 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR6322362.ke.tsv 35125 SRR6322362.se.tsv 88098 total ==> SRR6322362.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 2.27209e-05 2.99166e-06 PNS24247 1044 945 55.1033 6.42624 PNS24249 1928 1829 16.0088 0.964617 PNS24246 1044 945 55.1033 6.42624 PNS24248 1044 945 55.1033 6.42624 PNS24244 1471 1372 59.6813 4.79397 PNS24243 293 194 0 0 KQK14069 1603 1504 1038.52 76.0986 KQK14071 474 375 254.694 74.8512 ==> SRR6322362.se.tsv <== BRADI_1g14170v3 1405 BRADI_1g53295v3 107 BRADI_1g59795v3 272 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 5636 BRADI_1g74790v3 30 BRADI_1g09890v3 0 BRADI_1g77505v3 404 BRADI_1g48960v3 0 SRR6322362 completed mapping pipeline successfully