Starting /dee2/code/volunteer_pipeline.sh SRR6322363 current disk space = 1544051384320 free memory = 1603191348 SRR6322363 SRAfilesize 9d17e5a563ec7397a8063d39b258de01 SRR6322363.sra SRR6322363.sra file validated SRR6322363 is single end SRR6322363 is conventional basespace SRR6322363 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6395 34.0 33.0 34.0 31.0 34.0 2 32.78475 34.0 33.0 34.0 31.0 34.0 3 32.94875 34.0 33.0 34.0 32.0 34.0 4 32.99775 34.0 33.0 34.0 32.0 34.0 5 33.04125 34.0 33.0 34.0 32.0 34.0 6 36.8615 38.0 38.0 38.0 35.0 38.0 7 37.05525 38.0 38.0 38.0 36.0 38.0 8 37.23325 38.0 38.0 38.0 36.0 38.0 9 37.309 38.0 38.0 38.0 37.0 38.0 10 37.30375 38.0 38.0 38.0 37.0 38.0 11 37.28775 38.0 38.0 38.0 37.0 38.0 12 37.279 38.0 38.0 38.0 37.0 38.0 13 37.306 38.0 38.0 38.0 37.0 38.0 14 37.284 38.0 38.0 38.0 37.0 38.0 15 37.24775 38.0 38.0 38.0 37.0 38.0 16 37.17475 38.0 38.0 38.0 37.0 38.0 17 37.215 38.0 38.0 38.0 37.0 38.0 18 37.1915 38.0 38.0 38.0 37.0 38.0 19 37.21025 38.0 38.0 38.0 37.0 38.0 20 37.26525 38.0 38.0 38.0 37.0 38.0 21 37.21675 38.0 38.0 38.0 37.0 38.0 22 37.20975 38.0 38.0 38.0 37.0 38.0 23 37.267 38.0 38.0 38.0 37.0 38.0 24 37.2795 38.0 38.0 38.0 37.0 38.0 25 37.2545 38.0 38.0 38.0 36.0 38.0 26 37.22125 38.0 38.0 38.0 37.0 38.0 27 37.2395 38.0 38.0 38.0 37.0 38.0 28 37.24725 38.0 38.0 38.0 37.0 38.0 29 37.15375 38.0 38.0 38.0 37.0 38.0 30 37.20625 38.0 38.0 38.0 37.0 38.0 31 37.1595 38.0 38.0 38.0 37.0 38.0 32 37.12875 38.0 38.0 38.0 37.0 38.0 33 37.16 38.0 38.0 38.0 37.0 38.0 34 37.02725 38.0 38.0 38.0 36.0 38.0 35 37.13775 38.0 38.0 38.0 37.0 38.0 36 37.124 38.0 38.0 38.0 36.0 38.0 37 37.1285 38.0 38.0 38.0 36.0 38.0 38 37.04825 38.0 38.0 38.0 36.0 38.0 39 37.149 38.0 38.0 38.0 36.0 38.0 40 37.02775 38.0 38.0 38.0 36.0 38.0 41 37.0325 38.0 38.0 38.0 36.0 38.0 42 37.111 38.0 38.0 38.0 37.0 38.0 43 37.11775 38.0 38.0 38.0 36.0 38.0 44 37.10975 38.0 38.0 38.0 36.0 38.0 45 37.071 38.0 38.0 38.0 36.0 38.0 46 37.105 38.0 38.0 38.0 36.0 38.0 47 37.12425 38.0 38.0 38.0 37.0 38.0 48 37.03025 38.0 38.0 38.0 36.0 38.0 49 37.0305 38.0 38.0 38.0 36.0 38.0 50 37.0735 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 1.0 19 1.0 20 0.0 21 2.0 22 1.0 23 1.0 24 6.0 25 5.0 26 11.0 27 12.0 28 24.0 29 17.0 30 35.0 31 42.0 32 51.0 33 69.0 34 112.0 35 176.0 36 511.0 37 2919.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.909376636982714 10.424305919329493 8.17181770560503 34.494499738082766 2 23.775 12.25 33.225 30.75 3 21.4 14.95 26.35 37.3 4 25.2 22.15 22.7 29.95 5 25.650000000000002 27.275 23.775 23.3 6 23.775 30.225 24.224999999999998 21.775 7 19.400000000000002 25.85 35.775 18.975 8 20.625 25.275 29.049999999999997 25.05 9 19.75 23.5 31.724999999999998 25.025 10 19.875 34.325 26.924999999999997 18.875 11 25.874999999999996 25.474999999999998 23.25 25.4 12 23.799999999999997 21.75 25.4 29.049999999999997 13 21.875 26.275 28.000000000000004 23.849999999999998 14 22.1 25.95 26.3 25.650000000000002 15 23.325000000000003 24.575 26.5 25.6 16 23.549999999999997 24.6 26.325 25.525 17 22.05 26.525 26.275 25.15 18 22.1 24.75 25.874999999999996 27.275 19 22.650000000000002 25.85 26.05 25.45 20 23.0 25.0 26.775 25.224999999999998 21 21.825 25.874999999999996 26.450000000000003 25.85 22 22.75 26.775 25.900000000000002 24.575 23 23.599999999999998 25.15 26.650000000000002 24.6 24 23.799999999999997 24.7 25.3 26.200000000000003 25 22.725 27.925 24.9 24.45 26 22.900000000000002 26.1 25.525 25.474999999999998 27 22.3 26.224999999999998 25.575 25.900000000000002 28 23.9 25.825 24.625 25.650000000000002 29 23.400000000000002 26.900000000000002 25.424999999999997 24.275 30 21.0 25.775 26.55 26.674999999999997 31 22.875 26.974999999999998 25.775 24.375 32 24.474999999999998 25.5 25.85 24.175 33 22.95 23.724999999999998 26.35 26.974999999999998 34 22.7 25.75 25.775 25.775 35 22.05 26.0 26.125 25.825 36 22.325 24.825 27.175 25.674999999999997 37 22.975 26.6 25.55 24.875 38 23.599999999999998 26.125 24.75 25.525 39 22.8 23.95 26.85 26.400000000000002 40 22.900000000000002 26.700000000000003 24.525 25.874999999999996 41 23.375 24.975 26.875 24.775 42 22.825 25.7 25.8 25.674999999999997 43 23.625 25.775 25.0 25.6 44 22.75 26.3 26.5 24.45 45 22.675 25.374999999999996 25.525 26.424999999999997 46 22.925 25.724999999999998 26.1 25.25 47 22.925 25.3 26.674999999999997 25.1 48 22.8 25.95 26.424999999999997 24.825 49 23.25 26.025 25.974999999999998 24.75 50 22.5 25.124999999999996 26.05 26.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 3.0 22 3.0 23 2.0 24 1.0 25 5.5 26 10.0 27 15.0 28 20.0 29 33.5 30 47.0 31 47.5 32 48.0 33 76.0 34 104.0 35 116.5 36 129.0 37 168.0 38 207.0 39 224.5 40 242.0 41 272.5 42 303.0 43 311.5 44 320.0 45 346.0 46 372.0 47 353.5 48 335.0 49 340.0 50 345.0 51 310.0 52 275.0 53 261.0 54 247.0 55 227.5 56 208.0 57 172.0 58 136.0 59 146.0 60 156.0 61 145.5 62 135.0 63 113.5 64 92.0 65 89.0 66 86.0 67 70.0 68 54.0 69 51.0 70 48.0 71 38.0 72 28.0 73 23.0 74 18.0 75 16.5 76 15.0 77 10.5 78 6.0 79 4.5 80 3.0 81 2.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.6042296072507553 1.2 3 0.0 0.0 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTTTATTCGTCGTATAAATATATATGCTCACCCTCTCCAGTACGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013889 spots for SRR6322363.sra Written 1013889 spots for SRR6322363.sra Read 1013903 spots for SRR6322363.sra Written 1013903 spots for SRR6322363.sra SRR ids: ['SRR6322363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l3r1vk8y SRR6322363.sra spots: 20277794 blocks: [[1, 1013889], [1013890, 2027778], [2027779, 3041667], [3041668, 4055556], [4055557, 5069445], [5069446, 6083334], [6083335, 7097223], [7097224, 8111112], [8111113, 9125001], [9125002, 10138890], [10138891, 11152779], [11152780, 12166668], [12166669, 13180557], [13180558, 14194446], [14194447, 15208335], [15208336, 16222224], [16222225, 17236113], [17236114, 18250002], [18250003, 19263891], [19263892, 20277794]] SRR6322363 file size 3523670 SRR6322363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322363 SRR6322363_1.fastq Input file: SRR6322363_1.fastq trimmed: SRR6322363-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:50:50 2024 >> started Sat Dec 7 09:50:59 2024 >> done (9.491s) 20277794 reads processed; of these: 3413 ( 0.02%) short reads filtered out after trimming by size control 7936 ( 0.04%) empty reads filtered out after trimming by size control 20266445 (99.94%) reads available; of these: 136694 ( 0.67%) trimmed reads available after processing 20129751 (99.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 223 0.00% 19 242 0.00% 20 266 0.00% 21 323 0.00% 22 369 0.00% 23 852 0.00% 24 568 0.00% 25 636 0.00% 26 783 0.00% 27 636 0.00% 28 593 0.00% 29 638 0.00% 30 698 0.00% 31 745 0.00% 32 783 0.00% 33 874 0.00% 34 952 0.00% 35 1053 0.01% 36 1268 0.01% 37 1515 0.01% 38 1721 0.01% 39 2013 0.01% 40 2418 0.01% 41 3086 0.02% 42 3714 0.02% 43 4802 0.02% 44 6171 0.03% 45 8408 0.04% 46 10977 0.05% 47 16087 0.08% 48 25834 0.13% 49 37446 0.18% 50 20129751 99.33% 20266445 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=19 fanout-score=114.10 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.7 sequence=CTCCTCCTCCACGGCCTGGGTAACCACGGCCCGGATATCCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 09:51:11 Started mapping on | Dec 07 09:51:12 Finished on | Dec 07 09:51:31 Mapping speed, Million of reads per hour | 3839.96 Number of input reads | 20266445 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 19314395 Uniquely mapped reads % | 95.30% Average mapped length | 49.77 Number of splices: Total | 2923278 Number of splices: Annotated (sjdb) | 2820379 Number of splices: GT/AG | 2887749 Number of splices: GC/AG | 29070 Number of splices: AT/AC | 1892 Number of splices: Non-canonical | 4567 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483094 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 379180 % of reads mapped to too many loci | 1.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468956 468956 468956 N_multimapping 483094 483094 483094 N_noFeature 995889 18739407 1117574 N_ambiguous 491716 1340 39202 UnstrandedReadsAssigned:17826790 PositiveStrandReadsAssigned:573648 NegativeStrandReadsAssigned:18157619 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322363 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322363-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,266,445 reads, 17,838,532 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52973 SRR6322363.ke.tsv 35125 SRR6322363.se.tsv 88098 total ==> SRR6322363.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 2.48547e-05 2.92489e-06 PNS24247 1044 945 48.6577 5.07161 PNS24249 1928 1829 3.65012 0.196571 PNS24246 1044 945 48.6577 5.07161 PNS24248 1044 945 48.6577 5.07161 PNS24244 1471 1372 93.3769 6.70365 PNS24243 293 194 0 0 KQK14069 1603 1504 1735.14 113.635 KQK14071 474 375 323.337 84.9279 ==> SRR6322363.se.tsv <== BRADI_1g14170v3 2309 BRADI_1g53295v3 187 BRADI_1g59795v3 503 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 5819 BRADI_1g74790v3 17 BRADI_1g09890v3 0 BRADI_1g77505v3 340 BRADI_1g48960v3 0 SRR6322363 completed mapping pipeline successfully