Starting /dee2/code/volunteer_pipeline.sh SRR6322364 current disk space = 1544049606656 free memory = 1597352824 SRR6322364 SRAfilesize 08779696eae7af9daacea6d44453b27f SRR6322364.sra SRR6322364.sra file validated SRR6322364 is single end SRR6322364 is conventional basespace SRR6322364 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.24975 33.0 33.0 34.0 30.0 34.0 2 32.82525 34.0 33.0 34.0 31.0 34.0 3 32.9145 34.0 33.0 34.0 31.0 34.0 4 33.103 34.0 33.0 34.0 32.0 34.0 5 33.116 34.0 33.0 34.0 32.0 34.0 6 36.6935 38.0 37.0 38.0 34.0 38.0 7 36.9925 38.0 38.0 38.0 35.0 38.0 8 37.17425 38.0 38.0 38.0 36.0 38.0 9 37.1425 38.0 38.0 38.0 36.0 38.0 10 37.1195 38.0 38.0 38.0 36.0 38.0 11 37.1785 38.0 38.0 38.0 36.0 38.0 12 37.05575 38.0 38.0 38.0 36.0 38.0 13 37.04125 38.0 38.0 38.0 35.0 38.0 14 36.9835 38.0 38.0 38.0 35.0 38.0 15 36.97 38.0 38.0 38.0 35.0 38.0 16 36.9215 38.0 38.0 38.0 35.0 38.0 17 36.912 38.0 38.0 38.0 35.0 38.0 18 36.8025 38.0 38.0 38.0 34.0 38.0 19 36.748 38.0 38.0 38.0 34.0 38.0 20 36.779 38.0 38.0 38.0 34.0 38.0 21 36.61625 38.0 38.0 38.0 34.0 38.0 22 36.6975 38.0 38.0 38.0 34.0 38.0 23 36.6345 38.0 38.0 38.0 34.0 38.0 24 36.72525 38.0 38.0 38.0 34.0 38.0 25 36.889 38.0 38.0 38.0 35.0 38.0 26 36.9625 38.0 38.0 38.0 35.0 38.0 27 36.9245 38.0 38.0 38.0 35.0 38.0 28 37.04075 38.0 38.0 38.0 36.0 38.0 29 36.911 38.0 38.0 38.0 35.0 38.0 30 36.82725 38.0 38.0 38.0 35.0 38.0 31 36.72375 38.0 38.0 38.0 34.0 38.0 32 36.597 38.0 38.0 38.0 34.0 38.0 33 36.3785 38.0 37.0 38.0 33.0 38.0 34 36.15725 38.0 37.0 38.0 33.0 38.0 35 36.23725 38.0 37.0 38.0 33.0 38.0 36 36.3875 38.0 37.0 38.0 34.0 38.0 37 36.47525 38.0 38.0 38.0 34.0 38.0 38 36.6605 38.0 38.0 38.0 35.0 38.0 39 36.74575 38.0 38.0 38.0 35.0 38.0 40 36.7075 38.0 38.0 38.0 35.0 38.0 41 36.76725 38.0 38.0 38.0 35.0 38.0 42 36.805 38.0 38.0 38.0 36.0 38.0 43 36.89725 38.0 38.0 38.0 36.0 38.0 44 36.90375 38.0 38.0 38.0 36.0 38.0 45 36.94675 38.0 38.0 38.0 36.0 38.0 46 36.9115 38.0 38.0 38.0 36.0 38.0 47 36.9145 38.0 38.0 38.0 36.0 38.0 48 36.93575 38.0 38.0 38.0 36.0 38.0 49 36.8925 38.0 38.0 38.0 36.0 38.0 50 36.91825 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 3.0 20 3.0 21 7.0 22 7.0 23 6.0 24 5.0 25 7.0 26 5.0 27 11.0 28 10.0 29 25.0 30 33.0 31 69.0 32 72.0 33 107.0 34 152.0 35 285.0 36 800.0 37 2390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.67478168827733 11.008203228367293 8.097380259327865 30.21963482402752 2 26.150000000000002 9.700000000000001 30.95 33.2 3 21.475 13.825000000000001 27.125 37.574999999999996 4 25.174999999999997 17.325 23.225 34.275 5 28.849999999999998 21.9 24.6 24.65 6 26.674999999999997 27.55 22.7 23.075000000000003 7 22.55 25.174999999999997 33.2 19.075 8 21.9 25.650000000000002 28.675 23.775 9 21.45 24.275 30.825000000000003 23.45 10 21.65 31.624999999999996 25.8 20.925 11 25.1 26.450000000000003 23.400000000000002 25.05 12 24.325 23.35 26.400000000000002 25.924999999999997 13 23.375 25.4 26.6 24.625 14 24.099999999999998 25.55 25.3 25.05 15 23.625 24.425 26.5 25.45 16 22.75 24.7 25.3 27.250000000000004 17 23.825 23.7 26.1 26.375 18 23.599999999999998 23.525 27.224999999999998 25.650000000000002 19 24.45 23.674999999999997 26.224999999999998 25.650000000000002 20 23.225 24.474999999999998 26.325 25.974999999999998 21 22.725 25.874999999999996 25.35 26.05 22 23.200000000000003 25.0 25.55 26.25 23 24.975 24.7 24.325 26.0 24 23.474999999999998 25.825 24.525 26.174999999999997 25 24.775 24.875 25.15 25.2 26 24.075 24.65 25.7 25.575 27 23.9 27.425 24.05 24.625 28 22.875 26.325 25.324999999999996 25.474999999999998 29 23.974999999999998 25.124999999999996 24.45 26.450000000000003 30 23.375 25.374999999999996 25.55 25.7 31 24.0 25.025 23.7 27.275 32 23.375 25.474999999999998 24.7 26.450000000000003 33 23.799999999999997 25.6 25.1 25.5 34 24.224999999999998 24.9 25.324999999999996 25.55 35 24.525 24.525 24.325 26.625 36 24.8 24.925 26.125 24.15 37 24.474999999999998 23.65 25.650000000000002 26.224999999999998 38 24.375 24.474999999999998 25.6 25.55 39 24.099999999999998 24.55 25.95 25.4 40 25.0 25.825 24.275 24.9 41 23.525 25.5 25.624999999999996 25.35 42 23.75 25.624999999999996 24.575 26.05 43 24.15 25.2 23.575 27.075 44 24.075 25.624999999999996 24.825 25.474999999999998 45 23.35 25.374999999999996 25.1 26.174999999999997 46 24.4 24.575 24.65 26.375 47 24.075 24.75 25.5 25.674999999999997 48 23.474999999999998 25.674999999999997 25.85 25.0 49 25.324999999999996 24.15 24.7 25.825 50 24.425 25.874999999999996 24.474999999999998 25.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 4.0 25 9.0 26 14.0 27 12.5 28 11.0 29 20.5 30 30.0 31 36.0 32 42.0 33 63.5 34 85.0 35 110.5 36 136.0 37 150.0 38 164.0 39 191.0 40 218.0 41 232.0 42 246.0 43 287.0 44 328.0 45 334.5 46 341.0 47 328.5 48 316.0 49 317.0 50 318.0 51 298.5 52 279.0 53 259.0 54 239.0 55 239.0 56 239.0 57 204.0 58 169.0 59 168.5 60 168.0 61 162.0 62 156.0 63 139.0 64 122.0 65 119.0 66 116.0 67 97.0 68 78.0 69 62.0 70 46.0 71 43.0 72 40.0 73 41.0 74 42.0 75 34.0 76 26.0 77 19.0 78 12.0 79 9.5 80 7.0 81 6.5 82 6.0 83 4.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652597 spots for SRR6322364.sra Written 652597 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra Read 652585 spots for SRR6322364.sra Written 652585 spots for SRR6322364.sra SRR ids: ['SRR6322364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4qixbl24 SRR6322364.sra spots: 13051712 blocks: [[1, 652585], [652586, 1305170], [1305171, 1957755], [1957756, 2610340], [2610341, 3262925], [3262926, 3915510], [3915511, 4568095], [4568096, 5220680], [5220681, 5873265], [5873266, 6525850], [6525851, 7178435], [7178436, 7831020], [7831021, 8483605], [8483606, 9136190], [9136191, 9788775], [9788776, 10441360], [10441361, 11093945], [11093946, 11746530], [11746531, 12399115], [12399116, 13051712]] SRR6322364 file size 2264196 SRR6322364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322364 SRR6322364_1.fastq Input file: SRR6322364_1.fastq trimmed: SRR6322364-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:50:40 2024 >> started Sat Dec 7 09:50:46 2024 >> done (5.824s) 13051712 reads processed; of these: 342 ( 0.00%) short reads filtered out after trimming by size control 367 ( 0.00%) empty reads filtered out after trimming by size control 13051003 (99.99%) reads available; of these: 219616 ( 1.68%) trimmed reads available after processing 12831387 (98.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 78 0.00% 19 91 0.00% 20 164 0.00% 21 254 0.00% 22 512 0.00% 23 746 0.01% 24 952 0.01% 25 1191 0.01% 26 1464 0.01% 27 2074 0.02% 28 2985 0.02% 29 3872 0.03% 30 4892 0.04% 31 8250 0.06% 32 18327 0.14% 33 106425 0.82% 34 24732 0.19% 35 2419 0.02% 36 825 0.01% 37 665 0.01% 38 647 0.00% 39 700 0.01% 40 805 0.01% 41 839 0.01% 42 1055 0.01% 43 1346 0.01% 44 1665 0.01% 45 2149 0.02% 46 2960 0.02% 47 4594 0.04% 48 8141 0.06% 49 13797 0.11% 50 12831387 98.32% 13051003 reads passed initial QC criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=32 prefix-density=0.00 prefix-fanout=1.0 sequence=TCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=82.42 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.0 sequence=AGCAGCAGCAACAACAGGCGTTGCGGGGGCCCAGAGGATGCTGTCCCGAACAATGAAGTGGCAAAGCGGGGCGTCACCAGGCTTGATGTGCGCCGGCATCTTCCTTGGGTTGAAGTTTGACGTGTCGAGGTGGCACACAGCGAGTACCTCCATCCTGTCCGGTCCTCCACTGCTGCCAAGGTCCTCCTTCTCCAGC Started job on | Dec 07 09:50:55 Started mapping on | Dec 07 09:50:55 Finished on | Dec 07 09:51:13 Mapping speed, Million of reads per hour | 2610.20 Number of input reads | 13051003 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 12341371 Uniquely mapped reads % | 94.56% Average mapped length | 49.78 Number of splices: Total | 1865084 Number of splices: Annotated (sjdb) | 1794203 Number of splices: GT/AG | 1843278 Number of splices: GC/AG | 17684 Number of splices: AT/AC | 1087 Number of splices: Non-canonical | 3035 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294683 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 173530 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414949 414949 414949 N_multimapping 294683 294683 294683 N_noFeature 481508 11935039 549784 N_ambiguous 360621 967 22999 UnstrandedReadsAssigned:11499242 PositiveStrandReadsAssigned:405365 NegativeStrandReadsAssigned:11768588 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322364 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322364-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,051,003 reads, 11,358,345 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR6322364.ke.tsv 35125 SRR6322364.se.tsv 88098 total ==> SRR6322364.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 26.0202 4.05973 PNS24249 1928 1829 13.1632 1.06113 PNS24246 1044 945 26.0202 4.05973 PNS24248 1044 945 26.0202 4.05973 PNS24244 1471 1372 27.7761 2.98494 PNS24243 293 194 0 0 KQK14069 1603 1504 1081.32 106.004 KQK14071 474 375 261.937 102.987 ==> SRR6322364.se.tsv <== BRADI_1g14170v3 1472 BRADI_1g53295v3 90 BRADI_1g59795v3 168 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 4672 BRADI_1g74790v3 7 BRADI_1g09890v3 0 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR6322364 completed mapping pipeline successfully