Starting /dee2/code/volunteer_pipeline.sh SRR6322365 current disk space = 1543034916864 free memory = 1602935584 SRR6322365 SRAfilesize 92bccb3af50e41d89f464ebeca49c3e1 SRR6322365.sra SRR6322365.sra file validated SRR6322365 is single end SRR6322365 is conventional basespace SRR6322365 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.15125 33.0 33.0 34.0 2.0 34.0 2 32.406 34.0 33.0 34.0 28.0 34.0 3 32.57725 34.0 33.0 34.0 28.0 34.0 4 32.8525 34.0 33.0 34.0 32.0 34.0 5 33.0265 34.0 33.0 34.0 32.0 34.0 6 36.75725 38.0 37.0 38.0 34.0 38.0 7 37.0435 38.0 38.0 38.0 35.0 38.0 8 37.1445 38.0 38.0 38.0 36.0 38.0 9 37.22025 38.0 38.0 38.0 36.0 38.0 10 37.1585 38.0 38.0 38.0 36.0 38.0 11 37.12525 38.0 38.0 38.0 36.0 38.0 12 37.18275 38.0 38.0 38.0 36.0 38.0 13 37.004 38.0 38.0 38.0 36.0 38.0 14 37.06175 38.0 38.0 38.0 36.0 38.0 15 36.94775 38.0 38.0 38.0 35.0 38.0 16 37.04275 38.0 38.0 38.0 35.0 38.0 17 36.85425 38.0 38.0 38.0 34.0 38.0 18 36.7205 38.0 38.0 38.0 34.0 38.0 19 36.7245 38.0 38.0 38.0 34.0 38.0 20 36.72075 38.0 38.0 38.0 34.0 38.0 21 36.80825 38.0 38.0 38.0 34.0 38.0 22 36.55775 38.0 38.0 38.0 34.0 38.0 23 36.4845 38.0 37.0 38.0 34.0 38.0 24 36.638 38.0 37.0 38.0 34.0 38.0 25 36.75475 38.0 38.0 38.0 34.0 38.0 26 36.95275 38.0 38.0 38.0 35.0 38.0 27 36.93225 38.0 38.0 38.0 35.0 38.0 28 36.95975 38.0 38.0 38.0 35.0 38.0 29 36.904 38.0 38.0 38.0 35.0 38.0 30 36.785 38.0 38.0 38.0 35.0 38.0 31 36.507 38.0 38.0 38.0 34.0 38.0 32 36.47175 38.0 37.0 38.0 34.0 38.0 33 36.38675 38.0 37.0 38.0 33.0 38.0 34 36.17825 38.0 37.0 38.0 33.0 38.0 35 36.108 38.0 37.0 38.0 33.0 38.0 36 36.28775 38.0 37.0 38.0 33.0 38.0 37 36.36675 38.0 37.0 38.0 34.0 38.0 38 36.6145 38.0 37.0 38.0 34.0 38.0 39 36.59675 38.0 38.0 38.0 34.0 38.0 40 36.76925 38.0 38.0 38.0 35.0 38.0 41 36.86875 38.0 38.0 38.0 35.0 38.0 42 37.03375 38.0 38.0 38.0 36.0 38.0 43 37.05325 38.0 38.0 38.0 36.0 38.0 44 37.0255 38.0 38.0 38.0 36.0 38.0 45 37.0235 38.0 38.0 38.0 36.0 38.0 46 37.1365 38.0 38.0 38.0 36.0 38.0 47 37.15625 38.0 38.0 38.0 36.0 38.0 48 37.07175 38.0 38.0 38.0 36.0 38.0 49 36.98675 38.0 38.0 38.0 36.0 38.0 50 37.10675 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 3.0 21 3.0 22 2.0 23 5.0 24 3.0 25 4.0 26 7.0 27 12.0 28 20.0 29 23.0 30 40.0 31 66.0 32 72.0 33 113.0 34 185.0 35 314.0 36 944.0 37 2181.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.36042201311662 10.436270316509837 7.100085543199315 34.10322212717422 2 25.074999999999996 10.424999999999999 31.2 33.300000000000004 3 23.150000000000002 13.575000000000001 24.15 39.125 4 27.525 19.325 21.6 31.55 5 28.625 23.724999999999998 24.2 23.45 6 24.349999999999998 28.425 23.65 23.575 7 19.475 25.124999999999996 36.275 19.125 8 19.925 24.224999999999998 30.3 25.55 9 21.525 22.625 31.5 24.349999999999998 10 21.925 31.3 26.1 20.674999999999997 11 26.150000000000002 25.575 23.05 25.224999999999998 12 23.825 22.45 26.375 27.35 13 23.724999999999998 23.875 27.975 24.425 14 24.675 25.124999999999996 24.55 25.650000000000002 15 22.925 23.799999999999997 27.474999999999998 25.8 16 24.325 25.124999999999996 24.975 25.575 17 25.174999999999997 25.424999999999997 24.5 24.9 18 22.725 24.325 27.025 25.924999999999997 19 24.2 24.95 25.3 25.55 20 23.474999999999998 23.95 26.150000000000002 26.424999999999997 21 23.25 24.525 26.224999999999998 26.0 22 23.474999999999998 23.5 25.85 27.175 23 23.9 24.2 26.125 25.775 24 22.55 25.724999999999998 26.875 24.85 25 24.224999999999998 24.05 25.35 26.375 26 23.65 25.224999999999998 25.85 25.275 27 22.225 24.525 24.875 28.375 28 23.674999999999997 24.25 25.224999999999998 26.85 29 23.5 25.95 24.9 25.650000000000002 30 24.275 24.6 25.900000000000002 25.224999999999998 31 23.799999999999997 24.55 24.75 26.900000000000002 32 23.400000000000002 25.974999999999998 24.7 25.924999999999997 33 22.7 24.325 25.775 27.200000000000003 34 24.6 24.425 23.974999999999998 27.0 35 22.975 25.45 26.474999999999998 25.1 36 22.875 24.925 25.775 26.424999999999997 37 23.625 24.3 25.575 26.5 38 22.975 25.45 25.275 26.3 39 23.45 25.3 25.674999999999997 25.575 40 24.525 24.474999999999998 24.85 26.150000000000002 41 23.9 25.4 25.624999999999996 25.074999999999996 42 24.9 24.224999999999998 25.674999999999997 25.2 43 24.175 24.224999999999998 25.275 26.325 44 25.5 25.174999999999997 23.799999999999997 25.525 45 23.25 25.424999999999997 25.374999999999996 25.95 46 23.974999999999998 26.150000000000002 24.325 25.55 47 23.775 25.174999999999997 25.650000000000002 25.4 48 22.900000000000002 25.85 25.55 25.7 49 24.85 24.025 25.324999999999996 25.8 50 24.75 24.349999999999998 24.675 26.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 2.0 22 1.0 23 4.0 24 7.0 25 8.0 26 9.0 27 10.5 28 12.0 29 15.5 30 19.0 31 30.0 32 41.0 33 56.5 34 72.0 35 99.0 36 126.0 37 146.0 38 166.0 39 189.0 40 212.0 41 257.0 42 302.0 43 300.5 44 299.0 45 319.0 46 339.0 47 335.0 48 331.0 49 322.5 50 314.0 51 296.5 52 279.0 53 264.0 54 249.0 55 238.5 56 228.0 57 234.0 58 240.0 59 204.5 60 169.0 61 157.0 62 145.0 63 127.5 64 110.0 65 94.5 66 79.0 67 74.0 68 69.0 69 67.5 70 66.0 71 56.0 72 46.0 73 40.0 74 34.0 75 24.5 76 15.0 77 11.0 78 7.0 79 5.5 80 4.0 81 4.0 82 4.0 83 3.5 84 3.0 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.6043817678166709 1.2 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529312 spots for SRR6322365.sra Written 1529312 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra Read 1529306 spots for SRR6322365.sra Written 1529306 spots for SRR6322365.sra SRR ids: ['SRR6322365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_salcuiw8 SRR6322365.sra spots: 30586126 blocks: [[1, 1529306], [1529307, 3058612], [3058613, 4587918], [4587919, 6117224], [6117225, 7646530], [7646531, 9175836], [9175837, 10705142], [10705143, 12234448], [12234449, 13763754], [13763755, 15293060], [15293061, 16822366], [16822367, 18351672], [18351673, 19880978], [19880979, 21410284], [21410285, 22939590], [22939591, 24468896], [24468897, 25998202], [25998203, 27527508], [27527509, 29056814], [29056815, 30586126]] SRR6322365 file size 5320629 SRR6322365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322365 SRR6322365_1.fastq Input file: SRR6322365_1.fastq trimmed: SRR6322365-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:48:05 2024 >> started Sat Dec 7 11:48:25 2024 >> done (19.767s) 30586126 reads processed; of these: 574 ( 0.00%) short reads filtered out after trimming by size control 651 ( 0.00%) empty reads filtered out after trimming by size control 30584901 (100.00%) reads available; of these: 240235 ( 0.79%) trimmed reads available after processing 30344666 (99.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 103 0.00% 19 134 0.00% 20 191 0.00% 21 253 0.00% 22 498 0.00% 23 840 0.00% 24 1329 0.00% 25 1297 0.00% 26 1316 0.00% 27 1825 0.01% 28 2538 0.01% 29 3208 0.01% 30 4016 0.01% 31 6763 0.02% 32 15216 0.05% 33 88797 0.29% 34 22146 0.07% 35 2475 0.01% 36 1130 0.00% 37 924 0.00% 38 982 0.00% 39 1171 0.00% 40 1391 0.00% 41 1634 0.01% 42 2118 0.01% 43 2617 0.01% 44 3512 0.01% 45 4804 0.02% 46 6748 0.02% 47 10752 0.04% 48 18341 0.06% 49 31166 0.10% 50 30344666 99.21% 30584901 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=20 fanout-score=91.03 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.9 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 11:48:36 Started mapping on | Dec 07 11:48:36 Finished on | Dec 07 11:49:01 Mapping speed, Million of reads per hour | 4404.23 Number of input reads | 30584901 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 28981210 Uniquely mapped reads % | 94.76% Average mapped length | 49.80 Number of splices: Total | 4412871 Number of splices: Annotated (sjdb) | 4240114 Number of splices: GT/AG | 4362661 Number of splices: GC/AG | 40901 Number of splices: AT/AC | 2887 Number of splices: Non-canonical | 6422 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 686889 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 618015 % of reads mapped to too many loci | 2.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 916802 916802 916802 N_multimapping 686889 686889 686889 N_noFeature 1214320 28116502 1378055 N_ambiguous 754636 1856 55097 UnstrandedReadsAssigned:27012254 PositiveStrandReadsAssigned:862852 NegativeStrandReadsAssigned:27548058 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322365 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322365-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,584,901 reads, 26,449,806 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,279 rounds 52973 SRR6322365.ke.tsv 35125 SRR6322365.se.tsv 88098 total ==> SRR6322365.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.62521e-05 1.23082e-06 PNS24247 1044 945 80.5626 5.40396 PNS24249 1928 1829 14.4187 0.499714 PNS24246 1044 945 80.5626 5.40396 PNS24248 1044 945 80.5626 5.40396 PNS24244 1471 1372 108.893 5.03105 PNS24243 293 194 0 0 KQK14069 1603 1504 4463.58 188.125 KQK14071 474 375 946.657 160.019 ==> SRR6322365.se.tsv <== BRADI_1g14170v3 6032 BRADI_1g53295v3 185 BRADI_1g59795v3 492 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 10894 BRADI_1g74790v3 46 BRADI_1g09890v3 1 BRADI_1g77505v3 474 BRADI_1g48960v3 0 SRR6322365 completed mapping pipeline successfully