Starting /dee2/code/volunteer_pipeline.sh SRR6322366 current disk space = 1544049618944 free memory = 1602010096 SRR6322366 SRAfilesize 52795dcc65b814673f963a3bbbc54793 SRR6322366.sra SRR6322366.sra file validated SRR6322366 is single end SRR6322366 is conventional basespace SRR6322366 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1735 32.0 31.0 33.0 18.0 33.0 2 30.93475 33.0 31.0 33.0 25.0 34.0 3 31.0845 33.0 32.0 33.0 25.0 34.0 4 30.855 33.0 31.0 33.0 25.0 34.0 5 30.9105 33.0 32.0 33.0 25.0 34.0 6 33.033 36.0 31.0 38.0 26.0 38.0 7 33.86125 37.0 33.0 38.0 26.0 38.0 8 34.0485 37.0 33.0 38.0 26.0 38.0 9 34.12625 37.0 34.0 38.0 26.0 38.0 10 34.3635 37.0 34.0 38.0 26.0 38.0 11 34.4065 38.0 34.0 38.0 26.0 38.0 12 34.187 37.0 34.0 38.0 26.0 38.0 13 34.25325 37.0 34.0 38.0 26.0 38.0 14 34.15775 37.0 34.0 38.0 26.0 38.0 15 34.0305 37.0 33.0 38.0 26.0 38.0 16 33.7025 37.0 33.0 38.0 24.0 38.0 17 33.845 37.0 33.0 38.0 26.0 38.0 18 33.308 37.0 32.0 38.0 16.0 38.0 19 33.33275 37.0 32.0 38.0 16.0 38.0 20 33.41125 37.0 33.0 38.0 16.0 38.0 21 33.37675 37.0 32.0 38.0 16.0 38.0 22 33.0165 37.0 31.0 38.0 16.0 38.0 23 33.16325 37.0 31.0 38.0 16.0 38.0 24 33.484 37.0 33.0 38.0 24.0 38.0 25 33.91725 37.0 33.0 38.0 25.0 38.0 26 33.73775 37.0 33.0 38.0 24.0 38.0 27 33.76875 37.0 33.0 38.0 16.0 38.0 28 33.50925 37.0 33.0 38.0 16.0 38.0 29 32.96425 37.0 31.0 38.0 16.0 38.0 30 32.5815 37.0 29.0 38.0 16.0 38.0 31 32.3315 36.0 29.0 38.0 16.0 38.0 32 31.8395 36.0 28.0 38.0 16.0 38.0 33 31.6825 36.0 28.0 38.0 16.0 38.0 34 31.57125 36.0 28.0 38.0 16.0 38.0 35 31.7145 36.0 28.0 38.0 16.0 38.0 36 32.23625 36.0 29.0 38.0 16.0 38.0 37 32.44025 36.0 29.0 38.0 16.0 38.0 38 32.63775 37.0 31.0 38.0 16.0 38.0 39 33.191 37.0 33.0 38.0 16.0 38.0 40 33.56375 37.0 33.0 38.0 24.0 38.0 41 33.4175 37.0 33.0 38.0 16.0 38.0 42 33.51575 37.0 33.0 38.0 24.0 38.0 43 33.627 37.0 33.0 38.0 24.0 38.0 44 33.642 38.0 33.0 38.0 24.0 38.0 45 33.6925 38.0 34.0 38.0 16.0 38.0 46 33.79425 38.0 34.0 38.0 25.0 38.0 47 33.80075 38.0 34.0 38.0 24.0 38.0 48 33.801 38.0 34.0 38.0 25.0 38.0 49 33.46225 38.0 34.0 38.0 16.0 38.0 50 33.4555 38.0 34.0 38.0 16.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 4.0 18 6.0 19 7.0 20 10.0 21 5.0 22 12.0 23 16.0 24 26.0 25 41.0 26 77.0 27 132.0 28 173.0 29 217.0 30 274.0 31 329.0 32 322.0 33 411.0 34 457.0 35 516.0 36 537.0 37 421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.60342655580751 9.27185689090451 9.599395313681027 35.52532123960695 2 24.3 9.65 32.225 33.825 3 21.099999999999998 12.625 27.200000000000003 39.074999999999996 4 24.8 17.424999999999997 23.575 34.2 5 28.050000000000004 22.625 24.3 25.025 6 25.374999999999996 26.400000000000002 24.8 23.425 7 19.55 24.474999999999998 36.025 19.950000000000003 8 22.1 23.0 30.8 24.099999999999998 9 21.15 23.225 32.074999999999996 23.549999999999997 10 20.474999999999998 30.95 26.224999999999998 22.35 11 25.025 25.374999999999996 22.55 27.05 12 24.9 22.725 24.6 27.775 13 22.05 24.7 28.849999999999998 24.4 14 22.95 24.15 26.85 26.05 15 23.45 22.75 27.975 25.825 16 23.275000000000002 23.225 26.424999999999997 27.075 17 24.375 22.975 25.8 26.85 18 23.1 24.375 26.575 25.95 19 25.324999999999996 23.724999999999998 26.325 24.625 20 22.775000000000002 24.075 25.8 27.35 21 21.875 24.575 26.35 27.200000000000003 22 22.0 24.425 26.525 27.05 23 24.925 24.025 25.25 25.8 24 22.55 25.224999999999998 25.1 27.125 25 22.975 25.624999999999996 25.775 25.624999999999996 26 25.474999999999998 24.375 24.675 25.474999999999998 27 22.2 26.275 25.624999999999996 25.900000000000002 28 23.474999999999998 25.45 24.55 26.525 29 22.575 26.075 25.0 26.35 30 21.9 25.85 25.674999999999997 26.575 31 23.925 25.525 24.9 25.650000000000002 32 23.075000000000003 26.125 25.7 25.1 33 22.7 26.275 25.0 26.025 34 23.7 25.15 24.325 26.825 35 23.525 25.3 24.55 26.625 36 22.925 26.400000000000002 25.85 24.825 37 23.65 24.85 25.75 25.75 38 23.775 25.05 24.875 26.3 39 23.9 24.925 25.074999999999996 26.1 40 23.05 25.124999999999996 26.325 25.5 41 23.35 24.65 25.7 26.3 42 22.775000000000002 25.650000000000002 23.849999999999998 27.725 43 23.225 25.1 25.35 26.325 44 23.0 24.5 26.375 26.125 45 24.65 24.75 24.925 25.674999999999997 46 24.125 24.05 25.900000000000002 25.924999999999997 47 23.95 24.95 25.15 25.95 48 23.799999999999997 25.124999999999996 23.5 27.575 49 24.224999999999998 23.65 25.424999999999997 26.700000000000003 50 22.75 24.85 25.724999999999998 26.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 4.0 23 3.0 24 2.0 25 1.5 26 1.0 27 4.0 28 7.0 29 16.5 30 26.0 31 42.0 32 58.0 33 67.5 34 77.0 35 97.5 36 118.0 37 143.5 38 169.0 39 194.5 40 220.0 41 247.5 42 275.0 43 302.0 44 329.0 45 327.0 46 325.0 47 312.0 48 299.0 49 310.0 50 321.0 51 304.0 52 287.0 53 279.0 54 271.0 55 247.0 56 223.0 57 211.5 58 200.0 59 183.5 60 167.0 61 152.0 62 137.0 63 130.5 64 124.0 65 116.5 66 109.0 67 96.0 68 83.0 69 73.0 70 63.0 71 49.0 72 35.0 73 33.0 74 31.0 75 23.5 76 16.0 77 11.5 78 7.0 79 6.5 80 6.0 81 4.5 82 3.0 83 4.0 84 5.0 85 3.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0909090909091 98.1 2 0.8333333333333334 1.6500000000000001 3 0.050505050505050504 0.15 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra Rejected 614 READS because READLEN < 1 Read 614 spots for SRR6322366.sra Written 614 spots for SRR6322366.sra Rejected 611 READS because READLEN < 1 Read 611 spots for SRR6322366.sra Written 611 spots for SRR6322366.sra SRR ids: ['SRR6322366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_afww5rra SRR6322366.sra spots: 12223 blocks: [[1, 611], [612, 1222], [1223, 1833], [1834, 2444], [2445, 3055], [3056, 3666], [3667, 4277], [4278, 4888], [4889, 5499], [5500, 6110], [6111, 6721], [6722, 7332], [7333, 7943], [7944, 8554], [8555, 9165], [9166, 9776], [9777, 10387], [10388, 10998], [10999, 11609], [11610, 12223]] SRR6322366 file size 1626 SRR6322366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322366 SRR6322366_1.fastq Input file: SRR6322366_1.fastq trimmed: SRR6322366-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:52:06 2024 >> started Sat Dec 7 09:52:06 2024 >> done (0.011s) 12223 reads processed; of these: 4 ( 0.03%) short reads filtered out after trimming by size control 1 ( 0.01%) empty reads filtered out after trimming by size control 12218 (99.96%) reads available; of these: 595 ( 4.87%) trimmed reads available after processing 11623 (95.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.01% 21 1 0.01% 22 1 0.01% 23 5 0.04% 24 2 0.02% 25 6 0.05% 26 4 0.03% 27 7 0.06% 28 8 0.07% 29 7 0.06% 30 17 0.14% 31 14 0.11% 32 26 0.21% 33 60 0.49% 34 28 0.23% 35 7 0.06% 36 7 0.06% 37 4 0.03% 38 3 0.02% 39 4 0.03% 40 7 0.06% 41 13 0.11% 42 13 0.11% 43 15 0.12% 44 21 0.17% 45 31 0.25% 46 45 0.37% 47 51 0.42% 48 76 0.62% 49 111 0.91% 50 11623 95.13% 12218 reads passed initial QC criterion=sequence-density sequence-density=1.51 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=1 prefix-density=0.00 prefix-fanout=1.0 sequence=TCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=1.51 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=1 prefix-density=0.00 prefix-fanout=1.0 sequence=TCTCGTATGCCGTCTTCTGCTTG Started job on | Dec 07 09:52:14 Started mapping on | Dec 07 09:52:14 Finished on | Dec 07 09:52:15 Mapping speed, Million of reads per hour | 43.98 Number of input reads | 12218 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 11473 Uniquely mapped reads % | 93.90% Average mapped length | 49.60 Number of splices: Total | 1801 Number of splices: Annotated (sjdb) | 1725 Number of splices: GT/AG | 1780 Number of splices: GC/AG | 20 Number of splices: AT/AC | 0 Number of splices: Non-canonical | 1 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.95 Insertion rate per base | 0.00% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 182 % of reads mapped to too many loci | 1.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 462 462 462 N_multimapping 283 283 283 N_noFeature 438 11085 530 N_ambiguous 310 0 14 UnstrandedReadsAssigned:10725 PositiveStrandReadsAssigned:388 NegativeStrandReadsAssigned:10929 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322366 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322366-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,218 reads, 10,518 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 680 rounds 52973 SRR6322366.ke.tsv 35125 SRR6322366.se.tsv 88098 total ==> SRR6322366.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 1 106.885 KQK14071 474 375 0 0 ==> SRR6322366.se.tsv <== BRADI_1g14170v3 1 BRADI_1g53295v3 0 BRADI_1g59795v3 0 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 4 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 1 BRADI_1g48960v3 0 SRR6322366 completed mapping pipeline successfully