Starting /dee2/code/volunteer_pipeline.sh SRR6322367 current disk space = 1544024555520 free memory = 1601935768 SRR6322367 SRAfilesize bad44272a8dfda9c05ab8d4602718fb3 SRR6322367.sra SRR6322367.sra file validated SRR6322367 is single end SRR6322367 is conventional basespace SRR6322367 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.55525 34.0 33.0 34.0 25.0 34.0 2 32.57925 34.0 33.0 34.0 28.0 34.0 3 32.71925 34.0 33.0 34.0 30.0 34.0 4 32.83825 34.0 33.0 34.0 32.0 34.0 5 32.90325 34.0 33.0 34.0 32.0 34.0 6 36.88025 38.0 38.0 38.0 35.0 38.0 7 37.11275 38.0 38.0 38.0 36.0 38.0 8 37.15475 38.0 38.0 38.0 37.0 38.0 9 37.19725 38.0 38.0 38.0 37.0 38.0 10 37.24925 38.0 38.0 38.0 37.0 38.0 11 37.21425 38.0 38.0 38.0 37.0 38.0 12 37.2855 38.0 38.0 38.0 37.0 38.0 13 37.258 38.0 38.0 38.0 37.0 38.0 14 37.29475 38.0 38.0 38.0 37.0 38.0 15 37.28825 38.0 38.0 38.0 37.0 38.0 16 37.228 38.0 38.0 38.0 37.0 38.0 17 37.29125 38.0 38.0 38.0 37.0 38.0 18 37.3135 38.0 38.0 38.0 37.0 38.0 19 37.2735 38.0 38.0 38.0 37.0 38.0 20 37.23325 38.0 38.0 38.0 37.0 38.0 21 37.27775 38.0 38.0 38.0 37.0 38.0 22 37.224 38.0 38.0 38.0 37.0 38.0 23 37.1975 38.0 38.0 38.0 37.0 38.0 24 37.221 38.0 38.0 38.0 37.0 38.0 25 37.27525 38.0 38.0 38.0 37.0 38.0 26 37.196 38.0 38.0 38.0 37.0 38.0 27 37.248 38.0 38.0 38.0 37.0 38.0 28 37.19125 38.0 38.0 38.0 37.0 38.0 29 37.2295 38.0 38.0 38.0 37.0 38.0 30 37.25775 38.0 38.0 38.0 37.0 38.0 31 37.207 38.0 38.0 38.0 37.0 38.0 32 37.07225 38.0 38.0 38.0 37.0 38.0 33 37.1135 38.0 38.0 38.0 37.0 38.0 34 37.21275 38.0 38.0 38.0 37.0 38.0 35 37.19725 38.0 38.0 38.0 37.0 38.0 36 37.1865 38.0 38.0 38.0 37.0 38.0 37 37.2375 38.0 38.0 38.0 37.0 38.0 38 37.2485 38.0 38.0 38.0 37.0 38.0 39 37.188 38.0 38.0 38.0 37.0 38.0 40 37.17675 38.0 38.0 38.0 37.0 38.0 41 37.091 38.0 38.0 38.0 37.0 38.0 42 37.13825 38.0 38.0 38.0 37.0 38.0 43 37.109 38.0 38.0 38.0 37.0 38.0 44 37.1995 38.0 38.0 38.0 37.0 38.0 45 37.11775 38.0 38.0 38.0 37.0 38.0 46 37.124 38.0 38.0 38.0 37.0 38.0 47 37.15925 38.0 38.0 38.0 37.0 38.0 48 37.2165 38.0 38.0 38.0 37.0 38.0 49 37.1545 38.0 38.0 38.0 37.0 38.0 50 37.072 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 3.0 23 0.0 24 4.0 25 6.0 26 4.0 27 10.0 28 14.0 29 20.0 30 30.0 31 37.0 32 63.0 33 66.0 34 85.0 35 167.0 36 558.0 37 2917.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.089087462767395 11.806119685892229 8.421337665854319 32.68345518548605 2 26.075 10.15 30.25 33.525 3 21.075 12.975 25.7 40.25 4 26.35 16.875 23.674999999999997 33.1 5 28.975 22.400000000000002 23.325000000000003 25.3 6 25.724999999999998 26.075 24.05 24.15 7 21.575 24.15 35.05 19.225 8 21.45 23.775 29.849999999999998 24.925 9 22.075 23.625 31.5 22.8 10 23.775 30.75 25.275 20.200000000000003 11 25.7 24.3 24.325 25.674999999999997 12 24.075 22.275 27.1 26.55 13 23.325000000000003 24.45 26.924999999999997 25.3 14 24.0 24.875 26.0 25.124999999999996 15 22.6 24.55 27.375 25.474999999999998 16 23.525 24.05 24.8 27.625 17 23.425 23.599999999999998 26.025 26.950000000000003 18 22.95 24.65 25.525 26.875 19 23.75 24.099999999999998 25.8 26.35 20 24.125 24.6 26.400000000000002 24.875 21 23.525 24.3 25.85 26.325 22 24.075 24.9 24.525 26.5 23 23.225 25.575 25.6 25.6 24 24.625 23.175 26.375 25.825 25 24.65 23.974999999999998 26.474999999999998 24.9 26 23.400000000000002 24.75 26.224999999999998 25.624999999999996 27 23.674999999999997 23.275000000000002 25.4 27.650000000000002 28 24.85 24.099999999999998 24.925 26.125 29 23.45 24.675 25.775 26.1 30 24.025 25.1 24.675 26.200000000000003 31 25.124999999999996 23.549999999999997 24.625 26.700000000000003 32 24.224999999999998 25.324999999999996 24.474999999999998 25.974999999999998 33 23.75 24.5 25.924999999999997 25.825 34 23.05 24.55 24.85 27.55 35 23.5 24.8 25.124999999999996 26.575 36 24.15 24.075 25.650000000000002 26.125 37 24.474999999999998 24.325 24.55 26.650000000000002 38 22.900000000000002 25.7 25.7 25.7 39 24.0 24.675 24.8 26.525 40 25.35 24.3 22.775000000000002 27.575 41 23.65 24.725 25.025 26.6 42 24.275 24.3 25.25 26.174999999999997 43 24.825 23.5 24.975 26.700000000000003 44 23.375 25.7 25.1 25.825 45 23.65 24.0 25.474999999999998 26.875 46 24.375 24.75 23.674999999999997 27.200000000000003 47 23.974999999999998 24.975 24.45 26.6 48 23.9 24.4 24.7 27.0 49 25.275 24.15 24.55 26.025 50 23.075000000000003 26.400000000000002 23.45 27.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 4.0 26 7.0 27 11.0 28 15.0 29 23.5 30 32.0 31 37.0 32 42.0 33 53.5 34 65.0 35 91.0 36 117.0 37 137.0 38 157.0 39 191.5 40 226.0 41 236.0 42 246.0 43 280.0 44 314.0 45 310.0 46 306.0 47 318.0 48 330.0 49 321.0 50 312.0 51 306.5 52 301.0 53 272.0 54 243.0 55 226.5 56 210.0 57 201.5 58 193.0 59 190.5 60 188.0 61 170.5 62 153.0 63 144.0 64 135.0 65 123.0 66 111.0 67 105.5 68 100.0 69 82.0 70 64.0 71 56.0 72 48.0 73 44.5 74 41.0 75 29.5 76 18.0 77 15.0 78 12.0 79 12.0 80 12.0 81 6.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930907 spots for SRR6322367.sra Written 930907 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra Read 930896 spots for SRR6322367.sra Written 930896 spots for SRR6322367.sra SRR ids: ['SRR6322367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_azeyqazl SRR6322367.sra spots: 18617931 blocks: [[1, 930896], [930897, 1861792], [1861793, 2792688], [2792689, 3723584], [3723585, 4654480], [4654481, 5585376], [5585377, 6516272], [6516273, 7447168], [7447169, 8378064], [8378065, 9308960], [9308961, 10239856], [10239857, 11170752], [11170753, 12101648], [12101649, 13032544], [13032545, 13963440], [13963441, 14894336], [14894337, 15825232], [15825233, 16756128], [16756129, 17687024], [17687025, 18617931]] SRR6322367 file size 3234381 SRR6322367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322367 SRR6322367_1.fastq Input file: SRR6322367_1.fastq trimmed: SRR6322367-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:53:27 2024 >> started Sat Dec 7 09:53:43 2024 >> done (16.404s) 18617931 reads processed; of these: 4221 ( 0.02%) short reads filtered out after trimming by size control 11313 ( 0.06%) empty reads filtered out after trimming by size control 18602397 (99.92%) reads available; of these: 120168 ( 0.65%) trimmed reads available after processing 18482229 (99.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 193 0.00% 19 259 0.00% 20 286 0.00% 21 285 0.00% 22 322 0.00% 23 458 0.00% 24 919 0.00% 25 641 0.00% 26 523 0.00% 27 495 0.00% 28 512 0.00% 29 544 0.00% 30 549 0.00% 31 664 0.00% 32 721 0.00% 33 728 0.00% 34 856 0.00% 35 910 0.00% 36 1067 0.01% 37 1260 0.01% 38 1457 0.01% 39 1794 0.01% 40 2036 0.01% 41 2567 0.01% 42 3263 0.02% 43 3961 0.02% 44 5398 0.03% 45 7202 0.04% 46 9938 0.05% 47 13975 0.08% 48 22351 0.12% 49 34034 0.18% 50 18482229 99.35% 18602397 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=19 prefix-density=0.15 prefix-fanout=2.2 sequence=TCGTCGCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=26.91 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.9 sequence=GTGCTGCTGCATCTGCTCCTCCGTTGCGGATTTCTCGTAGCGGTTGTAGATGCCGCATGCCTTGCGCAGCTGCGCCTTCGTCGCGGATTTGTCGTAGCCATTGTTGACGGAGCTCCTCCCCCTGATGAGGCGGGAAAGGGAGGCTGGCATGGGAGTGTTGTTGGGAAGAGCGGACTTCCAGTATTCCTCGGCCGGAGCTCCAGTTGTTGCAT Started job on | Dec 07 09:53:55 Started mapping on | Dec 07 09:53:55 Finished on | Dec 07 09:54:14 Mapping speed, Million of reads per hour | 3524.66 Number of input reads | 18602397 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 17775097 Uniquely mapped reads % | 95.55% Average mapped length | 49.77 Number of splices: Total | 2708923 Number of splices: Annotated (sjdb) | 2594113 Number of splices: GT/AG | 2675812 Number of splices: GC/AG | 28053 Number of splices: AT/AC | 1542 Number of splices: Non-canonical | 3516 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491907 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 254797 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 335393 335393 335393 N_multimapping 491907 491907 491907 N_noFeature 691627 17418839 792018 N_ambiguous 279957 1018 24820 UnstrandedReadsAssigned:16803513 PositiveStrandReadsAssigned:355240 NegativeStrandReadsAssigned:16958259 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322367 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322367-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,602,397 reads, 16,664,832 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6322367.ke.tsv 35125 SRR6322367.se.tsv 88098 total ==> SRR6322367.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 56.6931 5.73321 PNS24249 1928 1829 37.5035 1.95955 PNS24246 1044 945 56.6931 5.73321 PNS24248 1044 945 56.6931 5.73321 PNS24244 1471 1372 89.4171 6.22824 PNS24243 293 194 0 0 KQK14069 1603 1504 22957.7 1458.74 KQK14071 474 375 5251.47 1338.29 ==> SRR6322367.se.tsv <== BRADI_1g14170v3 30400 BRADI_1g53295v3 156 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 535 BRADI_1g74790v3 323 BRADI_1g09890v3 223 BRADI_1g77505v3 148 BRADI_1g48960v3 0 SRR6322367 completed mapping pipeline successfully