Starting /dee2/code/volunteer_pipeline.sh SRR6322368 current disk space = 1544047120384 free memory = 1601900624 SRR6322368 SRAfilesize ba6bba884bfc77f98d760ead4defbc27 SRR6322368.sra SRR6322368.sra file validated SRR6322368 is single end SRR6322368 is conventional basespace SRR6322368 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47375 34.0 33.0 34.0 30.0 34.0 2 32.68125 34.0 33.0 34.0 30.0 34.0 3 32.82375 34.0 33.0 34.0 32.0 34.0 4 32.8635 34.0 33.0 34.0 32.0 34.0 5 32.9105 34.0 33.0 34.0 32.0 34.0 6 36.65125 38.0 37.0 38.0 34.0 38.0 7 37.0735 38.0 38.0 38.0 36.0 38.0 8 37.07575 38.0 38.0 38.0 36.0 38.0 9 37.17375 38.0 38.0 38.0 36.0 38.0 10 37.1695 38.0 38.0 38.0 37.0 38.0 11 37.24075 38.0 38.0 38.0 37.0 38.0 12 37.1035 38.0 38.0 38.0 36.0 38.0 13 37.17975 38.0 38.0 38.0 36.0 38.0 14 37.0915 38.0 38.0 38.0 36.0 38.0 15 37.14975 38.0 38.0 38.0 37.0 38.0 16 37.18525 38.0 38.0 38.0 36.0 38.0 17 37.21975 38.0 38.0 38.0 36.0 38.0 18 37.109 38.0 38.0 38.0 36.0 38.0 19 37.1415 38.0 38.0 38.0 36.0 38.0 20 37.2425 38.0 38.0 38.0 37.0 38.0 21 37.09925 38.0 38.0 38.0 37.0 38.0 22 37.174 38.0 38.0 38.0 36.0 38.0 23 37.114 38.0 38.0 38.0 36.0 38.0 24 37.2045 38.0 38.0 38.0 36.0 38.0 25 37.094 38.0 38.0 38.0 36.0 38.0 26 37.11325 38.0 38.0 38.0 36.0 38.0 27 37.07675 38.0 38.0 38.0 36.0 38.0 28 37.08275 38.0 38.0 38.0 36.0 38.0 29 37.105 38.0 38.0 38.0 36.0 38.0 30 37.111 38.0 38.0 38.0 36.0 38.0 31 37.1505 38.0 38.0 38.0 36.0 38.0 32 37.0325 38.0 38.0 38.0 36.0 38.0 33 37.046 38.0 38.0 38.0 36.0 38.0 34 36.93475 38.0 38.0 38.0 36.0 38.0 35 37.036 38.0 38.0 38.0 36.0 38.0 36 37.02875 38.0 38.0 38.0 36.0 38.0 37 37.06025 38.0 38.0 38.0 36.0 38.0 38 36.96225 38.0 38.0 38.0 36.0 38.0 39 37.10525 38.0 38.0 38.0 36.0 38.0 40 37.00425 38.0 38.0 38.0 36.0 38.0 41 37.0895 38.0 38.0 38.0 36.0 38.0 42 37.0405 38.0 38.0 38.0 36.0 38.0 43 37.08 38.0 38.0 38.0 36.0 38.0 44 37.06225 38.0 38.0 38.0 36.0 38.0 45 37.07125 38.0 38.0 38.0 36.0 38.0 46 37.051 38.0 38.0 38.0 36.0 38.0 47 37.04625 38.0 38.0 38.0 36.0 38.0 48 37.036 38.0 38.0 38.0 36.0 38.0 49 36.96825 38.0 38.0 38.0 36.0 38.0 50 36.9745 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 1.0 22 1.0 23 2.0 24 3.0 25 4.0 26 11.0 27 21.0 28 25.0 29 38.0 30 28.0 31 39.0 32 50.0 33 81.0 34 103.0 35 202.0 36 536.0 37 2844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.426624737945495 10.61320754716981 10.351153039832285 36.60901467505241 2 25.25 9.675 31.624999999999996 33.45 3 21.280320080020005 12.05301325331333 25.03125781445361 41.635408852213054 4 25.224999999999998 16.125 24.0 34.65 5 26.6 21.925 25.15 26.325 6 25.825 27.150000000000002 23.225 23.799999999999997 7 21.3 24.224999999999998 35.3 19.175 8 21.85 23.925 30.075000000000003 24.15 9 21.2 22.325 32.925 23.549999999999997 10 21.925 31.025000000000002 27.85 19.2 11 25.1 25.074999999999996 24.725 25.1 12 23.7 22.7 26.900000000000002 26.700000000000003 13 23.799999999999997 23.849999999999998 27.55 24.8 14 23.075000000000003 24.625 26.724999999999998 25.575 15 23.599999999999998 23.9 26.174999999999997 26.325 16 23.400000000000002 25.224999999999998 26.025 25.35 17 23.05 25.0 25.0 26.950000000000003 18 22.975 25.3 25.95 25.775 19 23.974999999999998 25.25 25.55 25.224999999999998 20 23.525 25.074999999999996 26.450000000000003 24.95 21 24.15 23.425 26.8 25.624999999999996 22 23.525 24.6 25.25 26.625 23 22.75 26.174999999999997 25.025 26.05 24 24.45 23.799999999999997 25.75 26.0 25 22.875 24.65 26.375 26.1 26 22.425 23.974999999999998 27.35 26.25 27 23.575 23.925 26.6 25.900000000000002 28 23.0 24.625 25.8 26.575 29 23.974999999999998 23.474999999999998 26.650000000000002 25.900000000000002 30 23.075000000000003 24.95 25.724999999999998 26.25 31 25.2 24.3 25.624999999999996 24.875 32 23.825 25.974999999999998 25.650000000000002 24.55 33 23.200000000000003 25.124999999999996 24.775 26.900000000000002 34 23.325000000000003 25.25 25.074999999999996 26.35 35 24.425 24.474999999999998 25.374999999999996 25.724999999999998 36 23.875 24.575 25.75 25.8 37 24.125 25.275 25.474999999999998 25.124999999999996 38 23.849999999999998 25.825 25.15 25.174999999999997 39 22.55 24.55 25.924999999999997 26.974999999999998 40 24.25 24.25 25.525 25.974999999999998 41 23.825 24.8 25.224999999999998 26.150000000000002 42 23.75 23.3 25.174999999999997 27.775 43 23.625 25.35 24.95 26.075 44 23.525 25.174999999999997 25.974999999999998 25.324999999999996 45 23.925 24.875 25.724999999999998 25.474999999999998 46 22.55 25.174999999999997 25.4 26.875 47 22.75 24.7 25.825 26.724999999999998 48 22.525000000000002 24.975 25.900000000000002 26.6 49 23.175 25.174999999999997 25.5 26.150000000000002 50 23.625 26.05 24.525 25.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 1.0 25 2.0 26 3.0 27 10.0 28 17.0 29 26.0 30 35.0 31 39.0 32 43.0 33 51.0 34 59.0 35 85.5 36 112.0 37 140.5 38 169.0 39 210.5 40 252.0 41 265.0 42 278.0 43 291.0 44 304.0 45 334.0 46 364.0 47 350.5 48 337.0 49 332.0 50 327.0 51 299.5 52 272.0 53 268.0 54 264.0 55 234.5 56 205.0 57 200.0 58 195.0 59 173.0 60 151.0 61 139.5 62 128.0 63 125.0 64 122.0 65 109.0 66 96.0 67 83.0 68 70.0 69 67.0 70 64.0 71 56.5 72 49.0 73 47.0 74 45.0 75 30.0 76 15.0 77 11.0 78 7.0 79 6.0 80 5.0 81 4.5 82 4.0 83 2.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013928 spots for SRR6322368.sra Written 1013928 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra Read 1013915 spots for SRR6322368.sra Written 1013915 spots for SRR6322368.sra SRR ids: ['SRR6322368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e7ol57a_ SRR6322368.sra spots: 20278313 blocks: [[1, 1013915], [1013916, 2027830], [2027831, 3041745], [3041746, 4055660], [4055661, 5069575], [5069576, 6083490], [6083491, 7097405], [7097406, 8111320], [8111321, 9125235], [9125236, 10139150], [10139151, 11153065], [11153066, 12166980], [12166981, 13180895], [13180896, 14194810], [14194811, 15208725], [15208726, 16222640], [16222641, 17236555], [17236556, 18250470], [18250471, 19264385], [19264386, 20278313]] SRR6322368 file size 3523762 SRR6322368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322368 SRR6322368_1.fastq Input file: SRR6322368_1.fastq trimmed: SRR6322368-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:53:56 2024 >> started Sat Dec 7 09:54:13 2024 >> done (17.039s) 20278313 reads processed; of these: 3452 ( 0.02%) short reads filtered out after trimming by size control 9334 ( 0.05%) empty reads filtered out after trimming by size control 20265527 (99.94%) reads available; of these: 145936 ( 0.72%) trimmed reads available after processing 20119591 (99.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 243 0.00% 19 252 0.00% 20 329 0.00% 21 347 0.00% 22 425 0.00% 23 869 0.00% 24 646 0.00% 25 713 0.00% 26 892 0.00% 27 662 0.00% 28 606 0.00% 29 694 0.00% 30 760 0.00% 31 798 0.00% 32 857 0.00% 33 879 0.00% 34 1016 0.01% 35 1163 0.01% 36 1370 0.01% 37 1595 0.01% 38 1776 0.01% 39 2158 0.01% 40 2534 0.01% 41 3144 0.02% 42 3849 0.02% 43 4878 0.02% 44 6450 0.03% 45 8634 0.04% 46 11713 0.06% 47 17415 0.09% 48 27528 0.14% 49 40741 0.20% 50 20119591 99.28% 20265527 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=20 prefix-density=0.10 prefix-fanout=2.4 sequence=GTTTCTGATCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=72.49 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.2 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGC Started job on | Dec 07 09:54:22 Started mapping on | Dec 07 09:54:22 Finished on | Dec 07 09:54:43 Mapping speed, Million of reads per hour | 3474.09 Number of input reads | 20265527 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 19176617 Uniquely mapped reads % | 94.63% Average mapped length | 49.75 Number of splices: Total | 2966958 Number of splices: Annotated (sjdb) | 2850655 Number of splices: GT/AG | 2930449 Number of splices: GC/AG | 29601 Number of splices: AT/AC | 2157 Number of splices: Non-canonical | 4751 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 589765 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 402523 % of reads mapped to too many loci | 1.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499145 499145 499145 N_multimapping 589765 589765 589765 N_noFeature 888601 18770159 999211 N_ambiguous 317823 1292 23643 UnstrandedReadsAssigned:17970193 PositiveStrandReadsAssigned:405166 NegativeStrandReadsAssigned:18153763 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322368 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322368-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,265,527 reads, 17,924,384 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6322368.ke.tsv 35125 SRR6322368.se.tsv 88098 total ==> SRR6322368.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 130.503 14.7622 PNS24247 1044 945 59.8916 6.00055 PNS24249 1928 1829 24.0131 1.24306 PNS24246 1044 945 59.8916 6.00055 PNS24248 1044 945 59.8916 6.00055 PNS24244 1471 1372 67.8093 4.67942 PNS24243 293 194 0 0 KQK14069 1603 1504 14545.1 915.644 KQK14071 474 375 2856.79 721.28 ==> SRR6322368.se.tsv <== BRADI_1g14170v3 18584 BRADI_1g53295v3 186 BRADI_1g59795v3 426 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 2855 BRADI_1g74790v3 144 BRADI_1g09890v3 36 BRADI_1g77505v3 173 BRADI_1g48960v3 0 SRR6322368 completed mapping pipeline successfully