Starting /dee2/code/volunteer_pipeline.sh SRR6322369 current disk space = 1543960444928 free memory = 1606102732 SRR6322369 SRAfilesize 94ebd04669e1be62ff77fa7835c73c0a SRR6322369.sra SRR6322369.sra file validated SRR6322369 is single end SRR6322369 is conventional basespace SRR6322369 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69825 34.0 33.0 34.0 31.0 34.0 2 32.6105 34.0 33.0 34.0 28.0 34.0 3 32.84075 34.0 33.0 34.0 32.0 34.0 4 32.81775 34.0 33.0 34.0 32.0 34.0 5 32.86625 34.0 33.0 34.0 32.0 34.0 6 36.67475 38.0 37.0 38.0 34.0 38.0 7 37.03875 38.0 38.0 38.0 36.0 38.0 8 37.15925 38.0 38.0 38.0 36.0 38.0 9 37.201 38.0 38.0 38.0 37.0 38.0 10 37.21275 38.0 38.0 38.0 36.0 38.0 11 37.282 38.0 38.0 38.0 37.0 38.0 12 37.08925 38.0 38.0 38.0 36.0 38.0 13 37.18475 38.0 38.0 38.0 37.0 38.0 14 37.194 38.0 38.0 38.0 37.0 38.0 15 37.2485 38.0 38.0 38.0 36.0 38.0 16 37.132 38.0 38.0 38.0 36.0 38.0 17 37.16675 38.0 38.0 38.0 36.0 38.0 18 37.13525 38.0 38.0 38.0 36.0 38.0 19 37.14825 38.0 38.0 38.0 37.0 38.0 20 37.21925 38.0 38.0 38.0 37.0 38.0 21 37.17575 38.0 38.0 38.0 36.0 38.0 22 37.20325 38.0 38.0 38.0 37.0 38.0 23 37.16425 38.0 38.0 38.0 36.0 38.0 24 37.0915 38.0 38.0 38.0 37.0 38.0 25 37.1965 38.0 38.0 38.0 36.0 38.0 26 37.1365 38.0 38.0 38.0 36.0 38.0 27 37.19325 38.0 38.0 38.0 36.0 38.0 28 37.15225 38.0 38.0 38.0 36.0 38.0 29 37.03675 38.0 38.0 38.0 36.0 38.0 30 37.15075 38.0 38.0 38.0 36.0 38.0 31 37.13975 38.0 38.0 38.0 37.0 38.0 32 37.04675 38.0 38.0 38.0 36.0 38.0 33 36.991 38.0 38.0 38.0 36.0 38.0 34 37.02775 38.0 38.0 38.0 36.0 38.0 35 37.0345 38.0 38.0 38.0 36.0 38.0 36 37.0985 38.0 38.0 38.0 36.0 38.0 37 37.07325 38.0 38.0 38.0 36.0 38.0 38 37.08575 38.0 38.0 38.0 36.0 38.0 39 37.07875 38.0 38.0 38.0 36.0 38.0 40 37.09125 38.0 38.0 38.0 36.0 38.0 41 36.96075 38.0 38.0 38.0 36.0 38.0 42 37.03925 38.0 38.0 38.0 36.0 38.0 43 37.07525 38.0 38.0 38.0 36.0 38.0 44 36.99525 38.0 38.0 38.0 36.0 38.0 45 36.98025 38.0 38.0 38.0 36.0 38.0 46 37.0985 38.0 38.0 38.0 36.0 38.0 47 36.98625 38.0 38.0 38.0 36.0 38.0 48 37.06075 38.0 38.0 38.0 36.0 38.0 49 36.96825 38.0 38.0 38.0 36.0 38.0 50 36.891 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 3.0 23 3.0 24 3.0 25 5.0 26 11.0 27 19.0 28 15.0 29 33.0 30 33.0 31 59.0 32 60.0 33 88.0 34 123.0 35 170.0 36 491.0 37 2879.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.08844953173777 12.278876170655566 10.093652445369408 37.539021852237255 2 26.525 9.925 32.25 31.3 3 21.80545136284071 13.003250812703177 24.756189047261813 40.4351087771943 4 26.825 17.025000000000002 21.65 34.5 5 29.375 21.15 24.025 25.45 6 27.224999999999998 25.674999999999997 23.45 23.65 7 22.05 24.075 33.825 20.05 8 22.5 24.625 27.750000000000004 25.124999999999996 9 22.775000000000002 23.05 30.4 23.775 10 23.724999999999998 29.725 25.275 21.275 11 25.8 24.825 23.849999999999998 25.525 12 24.25 22.55 26.1 27.1 13 24.675 22.95 25.974999999999998 26.400000000000002 14 23.474999999999998 23.200000000000003 26.5 26.825 15 23.825 22.05 26.1 28.025 16 25.025 23.175 24.3 27.500000000000004 17 25.2 22.525000000000002 25.674999999999997 26.6 18 22.95 24.55 26.075 26.424999999999997 19 24.675 24.15 24.075 27.1 20 25.324999999999996 24.075 24.95 25.650000000000002 21 24.55 23.575 24.925 26.950000000000003 22 25.55 23.25 24.8 26.400000000000002 23 25.25 24.05 24.95 25.75 24 23.7 24.349999999999998 24.425 27.525 25 25.474999999999998 22.900000000000002 24.224999999999998 27.400000000000002 26 24.325 23.75 25.324999999999996 26.6 27 25.4 23.525 25.25 25.825 28 25.4 23.025000000000002 24.75 26.825 29 25.825 22.7 25.0 26.474999999999998 30 25.6 23.425 24.85 26.125 31 25.4 24.375 23.825 26.400000000000002 32 25.025 24.025 25.074999999999996 25.874999999999996 33 24.95 23.150000000000002 25.224999999999998 26.674999999999997 34 25.174999999999997 24.075 22.825 27.925 35 25.2 23.425 24.15 27.224999999999998 36 23.599999999999998 24.525 25.05 26.825 37 24.975 22.900000000000002 23.175 28.95 38 25.05 23.474999999999998 23.200000000000003 28.275 39 25.224999999999998 24.5 23.75 26.525 40 25.124999999999996 24.125 24.25 26.5 41 24.425 25.224999999999998 23.7 26.650000000000002 42 24.75 24.6 24.5 26.150000000000002 43 25.15 24.625 23.799999999999997 26.424999999999997 44 25.474999999999998 23.35 23.775 27.400000000000002 45 24.6 22.875 24.675 27.85 46 25.25 25.275 23.375 26.1 47 24.375 25.074999999999996 24.099999999999998 26.450000000000003 48 24.725 22.6 25.174999999999997 27.500000000000004 49 24.975 24.425 23.625 26.974999999999998 50 25.35 23.95 24.7 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.0 24 3.0 25 5.0 26 7.0 27 11.0 28 15.0 29 18.5 30 22.0 31 33.5 32 45.0 33 63.0 34 81.0 35 85.0 36 89.0 37 110.0 38 131.0 39 164.0 40 197.0 41 221.0 42 245.0 43 254.5 44 264.0 45 284.5 46 305.0 47 286.5 48 268.0 49 284.0 50 300.0 51 289.5 52 279.0 53 238.5 54 198.0 55 206.5 56 215.0 57 223.0 58 231.0 59 209.5 60 188.0 61 184.5 62 181.0 63 187.5 64 194.0 65 163.5 66 133.0 67 127.5 68 122.0 69 109.0 70 96.0 71 84.5 72 73.0 73 57.5 74 42.0 75 36.0 76 30.0 77 25.5 78 21.0 79 18.0 80 15.0 81 10.0 82 5.0 83 3.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9539641943734 95.75 2 1.8925831202046037 3.6999999999999997 3 0.1278772378516624 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025575447570332477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATTTTATTGCGCGACGTATAATAGACTATGAGGAATGATAAAACAAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883727 spots for SRR6322369.sra Written 883727 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra Read 883710 spots for SRR6322369.sra Written 883710 spots for SRR6322369.sra SRR ids: ['SRR6322369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zvyebfjs SRR6322369.sra spots: 17674217 blocks: [[1, 883710], [883711, 1767420], [1767421, 2651130], [2651131, 3534840], [3534841, 4418550], [4418551, 5302260], [5302261, 6185970], [6185971, 7069680], [7069681, 7953390], [7953391, 8837100], [8837101, 9720810], [9720811, 10604520], [10604521, 11488230], [11488231, 12371940], [12371941, 13255650], [13255651, 14139360], [14139361, 15023070], [15023071, 15906780], [15906781, 16790490], [16790491, 17674217]] SRR6322369 file size 3069848 SRR6322369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322369 SRR6322369_1.fastq Input file: SRR6322369_1.fastq trimmed: SRR6322369-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:56:43 2024 >> started Sat Dec 7 09:56:56 2024 >> done (12.624s) 17674217 reads processed; of these: 2960 ( 0.02%) short reads filtered out after trimming by size control 11503 ( 0.07%) empty reads filtered out after trimming by size control 17659754 (99.92%) reads available; of these: 144297 ( 0.82%) trimmed reads available after processing 17515457 (99.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 208 0.00% 19 237 0.00% 20 238 0.00% 21 261 0.00% 22 335 0.00% 23 685 0.00% 24 565 0.00% 25 558 0.00% 26 694 0.00% 27 592 0.00% 28 569 0.00% 29 553 0.00% 30 700 0.00% 31 693 0.00% 32 801 0.00% 33 828 0.00% 34 990 0.01% 35 1053 0.01% 36 1258 0.01% 37 1488 0.01% 38 1717 0.01% 39 2075 0.01% 40 2448 0.01% 41 2998 0.02% 42 3693 0.02% 43 4945 0.03% 44 6362 0.04% 45 8583 0.05% 46 11584 0.07% 47 17251 0.10% 48 27769 0.16% 49 41566 0.24% 50 17515457 99.18% 17659754 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=31 prefix-density=0.45 prefix-fanout=1.9 sequence=TCCACGCTTTTGGGGATGGAGACGAAGGTTCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=27.11 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.1 sequence=GTGCACGGCCCGGACTGGCAGCCGTCGCCGCAGTAGGCGTCGCCCGTGCCGCAGTAGCCCCACTGGCTGCAGCACAGGTCATCCGGGCAGCCGCAGTTCTGCGCGGCCGCTGGGCCGGCGCCGGAGAGGAGGAGCACCGCCAGCCCGACAGCCAGCAGCGTCGCAACGAGCGGCATTGCGGATTTTGCCATCTGCACTTGCTTGATCAAGTGGTTAAGCGATCAAGG Started job on | Dec 07 09:57:11 Started mapping on | Dec 07 09:57:11 Finished on | Dec 07 09:57:40 Mapping speed, Million of reads per hour | 2192.25 Number of input reads | 17659754 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 15607800 Uniquely mapped reads % | 88.38% Average mapped length | 49.73 Number of splices: Total | 2074805 Number of splices: Annotated (sjdb) | 2010960 Number of splices: GT/AG | 2048624 Number of splices: GC/AG | 21403 Number of splices: AT/AC | 626 Number of splices: Non-canonical | 4152 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 609429 % of reads mapped to multiple loci | 3.45% Number of reads mapped to too many loci | 326314 % of reads mapped to too many loci | 1.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.27% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1442525 1442525 1442525 N_multimapping 609429 609429 609429 N_noFeature 707291 15279903 821145 N_ambiguous 225329 474 11808 UnstrandedReadsAssigned:14675180 PositiveStrandReadsAssigned:327423 NegativeStrandReadsAssigned:14774847 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322369 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322369-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,659,754 reads, 14,617,658 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR6322369.ke.tsv 35125 SRR6322369.se.tsv 88098 total ==> SRR6322369.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 92.0744 12.7858 PNS24247 1044 945 57.0275 7.01404 PNS24249 1928 1829 13.8103 0.877619 PNS24246 1044 945 57.0275 7.01404 PNS24248 1044 945 57.0275 7.01404 PNS24244 1471 1372 264.033 22.3676 PNS24243 293 194 0 0 KQK14069 1603 1504 4299.85 332.293 KQK14071 474 375 1356.17 420.339 ==> SRR6322369.se.tsv <== BRADI_1g14170v3 6133 BRADI_1g53295v3 124 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 1795 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 55 BRADI_1g48960v3 0 SRR6322369 completed mapping pipeline successfully