Starting /dee2/code/volunteer_pipeline.sh SRR6322370 current disk space = 1543898947584 free memory = 1603300248 SRR6322370 SRAfilesize 11d30c3fc630b3def01bd0962fca1226 SRR6322370.sra SRR6322370.sra file validated SRR6322370 is single end SRR6322370 is conventional basespace SRR6322370 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.829 34.0 33.0 34.0 25.0 34.0 2 32.62875 34.0 33.0 34.0 28.0 34.0 3 32.718 34.0 33.0 34.0 30.0 34.0 4 32.86525 34.0 33.0 34.0 32.0 34.0 5 32.996 34.0 33.0 34.0 32.0 34.0 6 36.852 38.0 38.0 38.0 35.0 38.0 7 37.17275 38.0 38.0 38.0 36.0 38.0 8 37.1925 38.0 38.0 38.0 37.0 38.0 9 37.17275 38.0 38.0 38.0 37.0 38.0 10 37.253 38.0 38.0 38.0 37.0 38.0 11 37.25675 38.0 38.0 38.0 37.0 38.0 12 37.27775 38.0 38.0 38.0 37.0 38.0 13 37.22675 38.0 38.0 38.0 37.0 38.0 14 37.21725 38.0 38.0 38.0 37.0 38.0 15 37.2395 38.0 38.0 38.0 37.0 38.0 16 37.251 38.0 38.0 38.0 37.0 38.0 17 37.25325 38.0 38.0 38.0 37.0 38.0 18 37.20525 38.0 38.0 38.0 37.0 38.0 19 37.21375 38.0 38.0 38.0 37.0 38.0 20 37.19525 38.0 38.0 38.0 37.0 38.0 21 37.25525 38.0 38.0 38.0 37.0 38.0 22 37.1625 38.0 38.0 38.0 37.0 38.0 23 37.22025 38.0 38.0 38.0 37.0 38.0 24 37.254 38.0 38.0 38.0 37.0 38.0 25 37.24825 38.0 38.0 38.0 37.0 38.0 26 37.22975 38.0 38.0 38.0 37.0 38.0 27 37.24 38.0 38.0 38.0 37.0 38.0 28 37.24525 38.0 38.0 38.0 37.0 38.0 29 37.19775 38.0 38.0 38.0 37.0 38.0 30 37.22375 38.0 38.0 38.0 37.0 38.0 31 37.18375 38.0 38.0 38.0 37.0 38.0 32 37.251 38.0 38.0 38.0 37.0 38.0 33 37.19325 38.0 38.0 38.0 37.0 38.0 34 37.09475 38.0 38.0 38.0 37.0 38.0 35 37.17225 38.0 38.0 38.0 37.0 38.0 36 37.16775 38.0 38.0 38.0 37.0 38.0 37 37.1195 38.0 38.0 38.0 36.0 38.0 38 37.22475 38.0 38.0 38.0 37.0 38.0 39 37.16775 38.0 38.0 38.0 37.0 38.0 40 37.15325 38.0 38.0 38.0 37.0 38.0 41 37.058 38.0 38.0 38.0 36.0 38.0 42 37.0955 38.0 38.0 38.0 37.0 38.0 43 37.07175 38.0 38.0 38.0 37.0 38.0 44 37.1375 38.0 38.0 38.0 37.0 38.0 45 37.11375 38.0 38.0 38.0 37.0 38.0 46 37.09775 38.0 38.0 38.0 36.0 38.0 47 37.08075 38.0 38.0 38.0 37.0 38.0 48 37.01025 38.0 38.0 38.0 36.0 38.0 49 37.1325 38.0 38.0 38.0 37.0 38.0 50 37.077 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.0 24 7.0 25 4.0 26 13.0 27 8.0 28 18.0 29 24.0 30 44.0 31 50.0 32 46.0 33 64.0 34 107.0 35 138.0 36 543.0 37 2921.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.58322129604733 9.814466254369455 8.685130411400914 31.917182038182307 2 24.6 10.225 31.65 33.525 3 20.75 15.6 27.500000000000004 36.15 4 26.75 20.625 22.75 29.875 5 27.725 25.474999999999998 23.875 22.925 6 24.575 29.2 24.5 21.725 7 19.75 21.725 36.9 21.625 8 20.575 24.95 30.049999999999997 24.425 9 20.375 22.95 32.574999999999996 24.099999999999998 10 23.200000000000003 31.974999999999998 25.6 19.225 11 26.25 25.124999999999996 22.125 26.5 12 23.9 23.150000000000002 25.8 27.150000000000002 13 22.675 26.075 27.35 23.9 14 23.7 24.925 27.425 23.95 15 24.15 22.8 27.625 25.424999999999997 16 23.474999999999998 23.3 26.85 26.375 17 24.4 25.424999999999997 25.5 24.675 18 23.175 24.55 26.700000000000003 25.575 19 24.85 23.974999999999998 26.325 24.85 20 23.275000000000002 25.7 25.674999999999997 25.35 21 22.475 25.6 25.6 26.325 22 24.775 25.6 23.799999999999997 25.825 23 23.125 25.074999999999996 26.825 24.975 24 23.05 24.85 25.825 26.275 25 23.425 24.925 25.124999999999996 26.525 26 24.3 24.8 25.474999999999998 25.424999999999997 27 22.900000000000002 24.925 26.35 25.825 28 23.200000000000003 24.725 25.55 26.525 29 24.224999999999998 24.775 24.525 26.474999999999998 30 23.025000000000002 24.65 24.825 27.500000000000004 31 23.849999999999998 23.5 25.6 27.05 32 22.675 26.25 25.7 25.374999999999996 33 22.7 24.2 26.674999999999997 26.424999999999997 34 23.075000000000003 25.374999999999996 24.45 27.1 35 22.425 26.55 25.324999999999996 25.7 36 22.825 24.825 26.3 26.05 37 25.124999999999996 24.625 23.925 26.325 38 23.175 26.1 26.150000000000002 24.575 39 24.275 24.4 25.474999999999998 25.85 40 24.95 25.6 24.275 25.174999999999997 41 23.025000000000002 25.474999999999998 26.85 24.65 42 23.925 24.45 26.700000000000003 24.925 43 23.7 24.675 25.25 26.375 44 23.35 24.725 27.1 24.825 45 23.025000000000002 23.724999999999998 26.25 27.0 46 23.775 25.624999999999996 24.8 25.8 47 22.650000000000002 26.3 24.925 26.125 48 24.4 24.55 25.5 25.55 49 23.599999999999998 25.35 23.95 27.1 50 23.075000000000003 25.324999999999996 25.25 26.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 1.0 23 3.0 24 5.0 25 7.5 26 10.0 27 16.0 28 22.0 29 26.5 30 31.0 31 35.0 32 39.0 33 57.0 34 75.0 35 105.5 36 136.0 37 159.0 38 182.0 39 215.5 40 249.0 41 258.5 42 268.0 43 303.0 44 338.0 45 327.0 46 316.0 47 329.5 48 343.0 49 329.5 50 316.0 51 284.0 52 252.0 53 265.5 54 279.0 55 244.5 56 210.0 57 193.5 58 177.0 59 162.0 60 147.0 61 139.0 62 131.0 63 129.0 64 127.0 65 109.5 66 92.0 67 80.5 68 69.0 69 70.5 70 72.0 71 58.0 72 44.0 73 35.0 74 26.0 75 21.5 76 17.0 77 15.5 78 14.0 79 9.5 80 5.0 81 2.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4779874213836478 0.95 3 0.0 0.0 4 0.05031446540880503 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.025 0.0 0.0 22 0.0 0.0 0.025 0.0 0.0 23 0.0 0.0 0.025 0.0 0.0 24 0.0 0.0 0.025 0.0 0.0 25 0.0 0.0 0.025 0.0 0.0 26 0.0 0.0 0.025 0.0 0.0 27 0.0 0.0 0.025 0.0 0.0 28 0.0 0.0 0.025 0.0 0.0 29 0.0 0.0 0.025 0.0 0.0 30 0.0 0.0 0.025 0.0 0.0 31 0.0 0.0 0.025 0.0 0.0 32 0.0 0.0 0.025 0.0 0.0 33 0.0 0.0 0.025 0.0 0.0 34 0.0 0.0 0.025 0.0 0.0 35 0.0 0.0 0.025 0.0 0.0 36 0.0 0.0 0.025 0.0 0.0 37 0.0 0.0 0.025 0.0 0.0 38 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932335 spots for SRR6322370.sra Written 932335 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra Read 932322 spots for SRR6322370.sra Written 932322 spots for SRR6322370.sra SRR ids: ['SRR6322370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ttcw0htx SRR6322370.sra spots: 18646453 blocks: [[1, 932322], [932323, 1864644], [1864645, 2796966], [2796967, 3729288], [3729289, 4661610], [4661611, 5593932], [5593933, 6526254], [6526255, 7458576], [7458577, 8390898], [8390899, 9323220], [9323221, 10255542], [10255543, 11187864], [11187865, 12120186], [12120187, 13052508], [13052509, 13984830], [13984831, 14917152], [14917153, 15849474], [15849475, 16781796], [16781797, 17714118], [17714119, 18646453]] SRR6322370 file size 3239354 SRR6322370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322370 SRR6322370_1.fastq Input file: SRR6322370_1.fastq trimmed: SRR6322370-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:59:14 2024 >> started Sat Dec 7 09:59:29 2024 >> done (14.843s) 18646453 reads processed; of these: 3966 ( 0.02%) short reads filtered out after trimming by size control 9486 ( 0.05%) empty reads filtered out after trimming by size control 18633001 (99.93%) reads available; of these: 128009 ( 0.69%) trimmed reads available after processing 18504992 (99.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 234 0.00% 19 311 0.00% 20 340 0.00% 21 402 0.00% 22 452 0.00% 23 626 0.00% 24 1144 0.01% 25 893 0.00% 26 711 0.00% 27 697 0.00% 28 639 0.00% 29 735 0.00% 30 733 0.00% 31 806 0.00% 32 830 0.00% 33 912 0.00% 34 997 0.01% 35 1096 0.01% 36 1208 0.01% 37 1445 0.01% 38 1645 0.01% 39 1993 0.01% 40 2311 0.01% 41 2744 0.01% 42 3446 0.02% 43 4406 0.02% 44 5753 0.03% 45 7580 0.04% 46 10421 0.06% 47 14702 0.08% 48 23176 0.12% 49 34621 0.19% 50 18504992 99.31% 18633001 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=1.6 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=15.39 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=AAACACACACATGACATGCCCATATGATTCATCATGAATTTAACGCTCGATCTGTTATACATTTATTCTTGAGATCCATGGATGGAACATGCTAGCTAGCCAGCACGGGGGATCTCGGCGACGGTGTCGACGAA Started job on | Dec 07 09:59:39 Started mapping on | Dec 07 09:59:39 Finished on | Dec 07 09:59:59 Mapping speed, Million of reads per hour | 3353.94 Number of input reads | 18633001 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 17632286 Uniquely mapped reads % | 94.63% Average mapped length | 49.78 Number of splices: Total | 2627112 Number of splices: Annotated (sjdb) | 2509701 Number of splices: GT/AG | 2593543 Number of splices: GC/AG | 27422 Number of splices: AT/AC | 1592 Number of splices: Non-canonical | 4555 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514924 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 391476 % of reads mapped to too many loci | 2.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485791 485791 485791 N_multimapping 514924 514924 514924 N_noFeature 907029 17261831 1020541 N_ambiguous 280470 1174 24846 UnstrandedReadsAssigned:16444787 PositiveStrandReadsAssigned:369281 NegativeStrandReadsAssigned:16586899 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322370 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322370-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,633,001 reads, 16,341,958 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR6322370.ke.tsv 35125 SRR6322370.se.tsv 88098 total ==> SRR6322370.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 34.8165 4.30834 PNS24247 1044 945 44.4361 4.87028 PNS24249 1928 1829 27.5709 1.5613 PNS24246 1044 945 44.4361 4.87028 PNS24248 1044 945 44.4361 4.87028 PNS24244 1471 1372 130.304 9.83681 PNS24243 293 194 0 0 KQK14069 1603 1504 20020.2 1378.7 KQK14071 474 375 3139.96 867.246 ==> SRR6322370.se.tsv <== BRADI_1g14170v3 25773 BRADI_1g53295v3 245 BRADI_1g59795v3 328 BRADI_1g07683v3 1 BRADI_1g00485v3 20 BRADI_1g20270v3 985 BRADI_1g74790v3 223 BRADI_1g09890v3 276 BRADI_1g77505v3 199 BRADI_1g48960v3 0 SRR6322370 completed mapping pipeline successfully