Starting /dee2/code/volunteer_pipeline.sh SRR6322371 current disk space = 1543044456448 free memory = 1602653200 SRR6322371 SRAfilesize e6384fbc626699400805e3a2262ede3e SRR6322371.sra SRR6322371.sra file validated SRR6322371 is single end SRR6322371 is conventional basespace SRR6322371 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.20875 34.0 33.0 34.0 28.0 34.0 2 32.73325 34.0 33.0 34.0 28.0 34.0 3 32.82425 34.0 33.0 34.0 31.0 34.0 4 32.90325 34.0 33.0 34.0 32.0 34.0 5 33.0285 34.0 33.0 34.0 32.0 34.0 6 36.93 38.0 38.0 38.0 35.0 38.0 7 37.12225 38.0 38.0 38.0 36.0 38.0 8 37.2005 38.0 38.0 38.0 36.0 38.0 9 37.26425 38.0 38.0 38.0 37.0 38.0 10 37.26775 38.0 38.0 38.0 37.0 38.0 11 37.3545 38.0 38.0 38.0 37.0 38.0 12 37.3605 38.0 38.0 38.0 37.0 38.0 13 37.31225 38.0 38.0 38.0 37.0 38.0 14 37.30575 38.0 38.0 38.0 37.0 38.0 15 37.3185 38.0 38.0 38.0 37.0 38.0 16 37.2315 38.0 38.0 38.0 37.0 38.0 17 37.30375 38.0 38.0 38.0 37.0 38.0 18 37.25575 38.0 38.0 38.0 37.0 38.0 19 37.256 38.0 38.0 38.0 37.0 38.0 20 37.2215 38.0 38.0 38.0 37.0 38.0 21 37.29775 38.0 38.0 38.0 37.0 38.0 22 37.25075 38.0 38.0 38.0 37.0 38.0 23 37.27575 38.0 38.0 38.0 37.0 38.0 24 37.256 38.0 38.0 38.0 37.0 38.0 25 37.2145 38.0 38.0 38.0 37.0 38.0 26 37.2965 38.0 38.0 38.0 37.0 38.0 27 37.277 38.0 38.0 38.0 37.0 38.0 28 37.252 38.0 38.0 38.0 37.0 38.0 29 37.18975 38.0 38.0 38.0 37.0 38.0 30 37.24775 38.0 38.0 38.0 37.0 38.0 31 37.3375 38.0 38.0 38.0 37.0 38.0 32 37.269 38.0 38.0 38.0 37.0 38.0 33 37.18175 38.0 38.0 38.0 37.0 38.0 34 37.1325 38.0 38.0 38.0 36.0 38.0 35 37.185 38.0 38.0 38.0 37.0 38.0 36 37.2065 38.0 38.0 38.0 37.0 38.0 37 37.2075 38.0 38.0 38.0 37.0 38.0 38 37.16075 38.0 38.0 38.0 37.0 38.0 39 37.1645 38.0 38.0 38.0 37.0 38.0 40 37.20575 38.0 38.0 38.0 37.0 38.0 41 37.14875 38.0 38.0 38.0 37.0 38.0 42 37.18175 38.0 38.0 38.0 37.0 38.0 43 37.17675 38.0 38.0 38.0 37.0 38.0 44 37.19125 38.0 38.0 38.0 37.0 38.0 45 37.11975 38.0 38.0 38.0 37.0 38.0 46 37.1295 38.0 38.0 38.0 37.0 38.0 47 37.15575 38.0 38.0 38.0 37.0 38.0 48 37.17425 38.0 38.0 38.0 37.0 38.0 49 37.151 38.0 38.0 38.0 37.0 38.0 50 37.08625 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 0.0 22 1.0 23 1.0 24 6.0 25 6.0 26 9.0 27 14.0 28 16.0 29 19.0 30 42.0 31 39.0 32 55.0 33 63.0 34 104.0 35 168.0 36 521.0 37 2929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.287762144942924 10.007963897000266 8.441730820281391 33.26254313777542 2 24.5 10.325 32.975 32.2 3 21.8 13.350000000000001 25.674999999999997 39.175 4 26.575 18.55 22.675 32.2 5 27.925 23.125 24.425 24.525 6 24.275 27.825 23.875 24.025 7 20.1 23.825 37.3 18.775 8 22.775000000000002 24.675 28.425 24.125 9 21.25 21.224999999999998 32.15 25.374999999999996 10 22.825 31.75 25.6 19.825 11 24.175 24.45 24.275 27.1 12 22.400000000000002 22.075 28.525 27.0 13 25.025 23.525 27.125 24.325 14 24.925 23.575 25.324999999999996 26.174999999999997 15 23.65 24.725 25.324999999999996 26.3 16 23.525 23.549999999999997 25.45 27.474999999999998 17 23.599999999999998 25.025 25.724999999999998 25.650000000000002 18 23.225 23.75 26.275 26.75 19 24.675 24.975 24.5 25.85 20 24.425 24.474999999999998 25.45 25.650000000000002 21 23.775 24.175 26.35 25.7 22 24.75 25.1 23.799999999999997 26.35 23 23.425 25.2 24.675 26.700000000000003 24 22.475 24.175 26.900000000000002 26.450000000000003 25 24.425 25.8 23.400000000000002 26.375 26 23.175 25.025 25.2 26.6 27 22.425 24.375 26.25 26.950000000000003 28 23.925 25.35 24.3 26.424999999999997 29 23.549999999999997 24.975 25.650000000000002 25.825 30 23.125 23.7 25.825 27.35 31 23.45 25.8 24.3 26.450000000000003 32 24.55 25.0 25.0 25.45 33 23.825 23.775 26.575 25.825 34 24.85 23.9 24.9 26.35 35 23.375 24.625 25.775 26.224999999999998 36 23.775 25.05 24.75 26.424999999999997 37 24.25 25.45 23.849999999999998 26.450000000000003 38 23.849999999999998 24.175 26.075 25.900000000000002 39 24.4 24.9 25.124999999999996 25.575 40 25.55 24.775 24.075 25.6 41 23.549999999999997 25.8 24.3 26.35 42 23.7 25.174999999999997 25.05 26.075 43 24.05 24.05 25.95 25.95 44 24.0 24.775 25.75 25.474999999999998 45 22.825 25.0 25.85 26.325 46 24.875 24.474999999999998 23.925 26.724999999999998 47 24.975 24.125 24.725 26.174999999999997 48 23.549999999999997 24.5 25.650000000000002 26.3 49 23.474999999999998 24.275 24.85 27.400000000000002 50 23.35 25.3 26.224999999999998 25.124999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 3.5 22 6.0 23 5.5 24 5.0 25 6.0 26 7.0 27 10.0 28 13.0 29 19.0 30 25.0 31 35.0 32 45.0 33 52.5 34 60.0 35 92.0 36 124.0 37 148.5 38 173.0 39 187.5 40 202.0 41 230.5 42 259.0 43 271.5 44 284.0 45 304.0 46 324.0 47 338.0 48 352.0 49 342.0 50 332.0 51 293.5 52 255.0 53 260.5 54 266.0 55 248.0 56 230.0 57 215.5 58 201.0 59 194.5 60 188.0 61 173.0 62 158.0 63 135.0 64 112.0 65 115.0 66 118.0 67 98.0 68 78.0 69 67.0 70 56.0 71 50.0 72 44.0 73 40.0 74 36.0 75 29.5 76 23.0 77 15.5 78 8.0 79 7.5 80 7.0 81 5.5 82 4.0 83 2.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837791 spots for SRR6322371.sra Written 837791 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra Read 837782 spots for SRR6322371.sra Written 837782 spots for SRR6322371.sra SRR ids: ['SRR6322371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bkfjh1vb SRR6322371.sra spots: 16755649 blocks: [[1, 837782], [837783, 1675564], [1675565, 2513346], [2513347, 3351128], [3351129, 4188910], [4188911, 5026692], [5026693, 5864474], [5864475, 6702256], [6702257, 7540038], [7540039, 8377820], [8377821, 9215602], [9215603, 10053384], [10053385, 10891166], [10891167, 11728948], [11728949, 12566730], [12566731, 13404512], [13404513, 14242294], [14242295, 15080076], [15080077, 15917858], [15917859, 16755649]] SRR6322371 file size 2909769 SRR6322371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322371 SRR6322371_1.fastq Input file: SRR6322371_1.fastq trimmed: SRR6322371-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:47:16 2024 >> started Sat Dec 7 11:47:26 2024 >> done (10.296s) 16755649 reads processed; of these: 2829 ( 0.02%) short reads filtered out after trimming by size control 5856 ( 0.03%) empty reads filtered out after trimming by size control 16746964 (99.95%) reads available; of these: 113506 ( 0.68%) trimmed reads available after processing 16633458 (99.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 175 0.00% 19 224 0.00% 20 277 0.00% 21 293 0.00% 22 351 0.00% 23 509 0.00% 24 950 0.01% 25 680 0.00% 26 589 0.00% 27 557 0.00% 28 562 0.00% 29 562 0.00% 30 664 0.00% 31 675 0.00% 32 709 0.00% 33 757 0.00% 34 860 0.01% 35 959 0.01% 36 1041 0.01% 37 1212 0.01% 38 1388 0.01% 39 1623 0.01% 40 2026 0.01% 41 2439 0.01% 42 2977 0.02% 43 3850 0.02% 44 5103 0.03% 45 6686 0.04% 46 9216 0.06% 47 13219 0.08% 48 20893 0.12% 49 31480 0.19% 50 16633458 99.32% 16746964 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=26 prefix-density=0.10 prefix-fanout=1.9 sequence=CCTGCAGTTGTCGCAGCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=17.68 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.5 sequence=GTGCTGCTGCATCTGCTCCTCCGTTGCGGATTTCTCGTAGCGGTTGTAGATGCCGCATGCCTTGCGCAGCTGCGCCTTCGTCGCGGATTTGTCGTAGCCATTGTTGACGGAGCTCCTCCCCCTGATGAGGCGGGAAAGGGAGGCTGGCATGGGAGTGTTGTTGGGAAGAGCGGACTTCCAGTATTCCTCGGCCGGAGCTCCAGTTGTTG Started job on | Dec 07 11:47:37 Started mapping on | Dec 07 11:47:37 Finished on | Dec 07 11:47:52 Mapping speed, Million of reads per hour | 4019.27 Number of input reads | 16746964 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 15984749 Uniquely mapped reads % | 95.45% Average mapped length | 49.78 Number of splices: Total | 2352404 Number of splices: Annotated (sjdb) | 2260676 Number of splices: GT/AG | 2324415 Number of splices: GC/AG | 22864 Number of splices: AT/AC | 1312 Number of splices: Non-canonical | 3813 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427616 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 259513 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 334599 334599 334599 N_multimapping 427616 427616 427616 N_noFeature 657088 15662793 747821 N_ambiguous 246965 771 16294 UnstrandedReadsAssigned:15080696 PositiveStrandReadsAssigned:321185 NegativeStrandReadsAssigned:15220634 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322371 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322371-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,746,964 reads, 14,943,408 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR6322371.ke.tsv 35125 SRR6322371.se.tsv 88098 total ==> SRR6322371.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 108.97 14.6796 PNS24247 1044 945 34.3126 4.09405 PNS24249 1928 1829 17.6872 1.09038 PNS24246 1044 945 34.3126 4.09405 PNS24248 1044 945 34.3126 4.09405 PNS24244 1471 1372 91.405 7.51186 PNS24243 293 194 0 0 KQK14069 1603 1504 5001.83 374.984 KQK14071 474 375 990.354 297.777 ==> SRR6322371.se.tsv <== BRADI_1g14170v3 6631 BRADI_1g53295v3 119 BRADI_1g59795v3 141 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1896 BRADI_1g74790v3 291 BRADI_1g09890v3 1 BRADI_1g77505v3 136 BRADI_1g48960v3 0 SRR6322371 completed mapping pipeline successfully