Starting /dee2/code/volunteer_pipeline.sh SRR6322372 current disk space = 1543125102592 free memory = 1606461168 SRR6322372 SRAfilesize f818ecea25df75277189736d311de9af SRR6322372.sra SRR6322372.sra file validated SRR6322372 is single end SRR6322372 is conventional basespace SRR6322372 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70225 33.0 33.0 34.0 31.0 34.0 2 32.8875 34.0 33.0 34.0 32.0 34.0 3 32.916 34.0 33.0 34.0 32.0 34.0 4 33.03075 34.0 33.0 34.0 32.0 34.0 5 33.08775 34.0 33.0 34.0 32.0 34.0 6 36.69 38.0 37.0 38.0 34.0 38.0 7 37.0575 38.0 38.0 38.0 35.0 38.0 8 37.16 38.0 38.0 38.0 36.0 38.0 9 37.24175 38.0 38.0 38.0 36.0 38.0 10 37.27 38.0 38.0 38.0 36.0 38.0 11 37.264 38.0 38.0 38.0 36.0 38.0 12 37.19775 38.0 38.0 38.0 36.0 38.0 13 37.116 38.0 38.0 38.0 35.0 38.0 14 37.1135 38.0 38.0 38.0 36.0 38.0 15 36.929 38.0 38.0 38.0 35.0 38.0 16 36.953 38.0 38.0 38.0 35.0 38.0 17 36.9645 38.0 38.0 38.0 35.0 38.0 18 36.865 38.0 38.0 38.0 35.0 38.0 19 36.8915 38.0 38.0 38.0 35.0 38.0 20 36.8915 38.0 38.0 38.0 35.0 38.0 21 36.81075 38.0 38.0 38.0 34.0 38.0 22 36.6795 38.0 38.0 38.0 34.0 38.0 23 36.59075 38.0 37.0 38.0 34.0 38.0 24 36.6805 38.0 38.0 38.0 34.0 38.0 25 36.87575 38.0 38.0 38.0 35.0 38.0 26 37.02875 38.0 38.0 38.0 36.0 38.0 27 37.0265 38.0 38.0 38.0 36.0 38.0 28 37.02825 38.0 38.0 38.0 36.0 38.0 29 37.01775 38.0 38.0 38.0 35.0 38.0 30 36.8455 38.0 38.0 38.0 35.0 38.0 31 36.6175 38.0 38.0 38.0 34.0 38.0 32 36.3485 38.0 37.0 38.0 33.0 38.0 33 36.28925 38.0 37.0 38.0 33.0 38.0 34 36.19725 38.0 37.0 38.0 33.0 38.0 35 36.29525 38.0 37.0 38.0 33.0 38.0 36 36.4425 38.0 37.0 38.0 34.0 38.0 37 36.585 38.0 37.0 38.0 34.0 38.0 38 36.63625 38.0 38.0 38.0 34.0 38.0 39 36.73 38.0 38.0 38.0 35.0 38.0 40 36.90425 38.0 38.0 38.0 35.0 38.0 41 36.888 38.0 38.0 38.0 35.0 38.0 42 36.91875 38.0 38.0 38.0 36.0 38.0 43 36.9775 38.0 38.0 38.0 36.0 38.0 44 37.06525 38.0 38.0 38.0 36.0 38.0 45 37.07675 38.0 38.0 38.0 36.0 38.0 46 37.09425 38.0 38.0 38.0 36.0 38.0 47 37.04175 38.0 38.0 38.0 36.0 38.0 48 37.11525 38.0 38.0 38.0 36.0 38.0 49 37.10775 38.0 38.0 38.0 36.0 38.0 50 37.0245 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 1.0 23 2.0 24 1.0 25 2.0 26 6.0 27 7.0 28 17.0 29 27.0 30 39.0 31 60.0 32 81.0 33 97.0 34 178.0 35 295.0 36 808.0 37 2373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.85391213932935 9.357941252924357 8.994021315310631 35.794125292435666 2 23.075000000000003 11.35 33.800000000000004 31.775 3 20.210105052526263 16.283141570785393 27.63881940970485 35.867933966983486 4 24.9 23.3 23.65 28.15 5 27.35 27.325 23.075000000000003 22.25 6 22.925 31.95 23.674999999999997 21.45 7 17.65 24.375 39.15 18.825 8 19.85 24.975 29.65 25.525 9 19.225 22.825 32.75 25.2 10 20.5 33.324999999999996 26.75 19.425 11 24.825 24.575 23.075000000000003 27.525 12 22.45 22.5 26.35 28.7 13 22.275 24.65 28.225 24.85 14 21.7 25.6 27.1 25.6 15 22.8 24.0 26.775 26.424999999999997 16 22.375 25.724999999999998 26.25 25.650000000000002 17 22.85 24.625 27.900000000000002 24.625 18 23.0 25.775 25.650000000000002 25.575 19 23.150000000000002 26.25 24.825 25.775 20 23.275000000000002 25.924999999999997 26.200000000000003 24.6 21 21.725 25.35 26.55 26.375 22 22.775000000000002 25.374999999999996 26.424999999999997 25.424999999999997 23 23.799999999999997 24.825 26.875 24.5 24 22.3 25.4 26.724999999999998 25.575 25 22.1 26.55 25.6 25.75 26 22.3 26.674999999999997 25.25 25.775 27 22.875 25.85 24.875 26.400000000000002 28 22.975 26.400000000000002 25.75 24.875 29 22.825 25.4 26.974999999999998 24.8 30 21.775 25.474999999999998 26.924999999999997 25.825 31 23.525 26.450000000000003 25.074999999999996 24.95 32 23.025000000000002 25.324999999999996 27.400000000000002 24.25 33 23.225 24.9 26.150000000000002 25.724999999999998 34 22.5 27.175 25.5 24.825 35 23.3 25.7 25.8 25.2 36 22.0 26.125 25.575 26.3 37 22.25 25.7 25.650000000000002 26.400000000000002 38 22.45 26.0 25.974999999999998 25.575 39 22.650000000000002 25.7 24.725 26.924999999999997 40 22.85 25.8 26.174999999999997 25.174999999999997 41 22.725 26.325 25.15 25.8 42 22.85 26.950000000000003 24.7 25.5 43 23.025000000000002 24.95 26.200000000000003 25.825 44 23.075000000000003 25.974999999999998 25.8 25.15 45 23.25 25.5 25.25 26.0 46 23.175 26.400000000000002 24.875 25.55 47 22.425 27.1 27.025 23.45 48 23.0 25.374999999999996 24.75 26.875 49 23.150000000000002 25.874999999999996 24.925 26.05 50 23.075000000000003 25.45 25.525 25.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 2.0 19 1.5 20 1.0 21 1.5 22 2.0 23 3.5 24 5.0 25 8.5 26 12.0 27 20.0 28 28.0 29 37.5 30 47.0 31 57.5 32 68.0 33 85.0 34 102.0 35 129.0 36 156.0 37 179.0 38 202.0 39 228.5 40 255.0 41 280.5 42 306.0 43 329.0 44 352.0 45 337.5 46 323.0 47 315.5 48 308.0 49 314.0 50 320.0 51 301.0 52 282.0 53 261.0 54 240.0 55 211.5 56 183.0 57 168.0 58 153.0 59 149.5 60 146.0 61 129.5 62 113.0 63 100.5 64 88.0 65 89.5 66 91.0 67 78.0 68 65.0 69 55.5 70 46.0 71 45.5 72 45.0 73 35.5 74 26.0 75 20.0 76 14.0 77 11.5 78 9.0 79 6.5 80 4.0 81 3.5 82 3.0 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8249999999999997 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.025 0.0 0.0 0.0 15 0.0 0.025 0.0 0.0 0.0 16 0.0 0.025 0.0 0.0 0.0 17 0.0 0.025 0.0 0.0 0.0 18 0.0 0.025 0.0 0.0 0.0 19 0.0 0.025 0.0 0.0 0.0 20 0.0 0.025 0.0 0.0 0.0 21 0.0 0.025 0.0 0.0 0.0 22 0.0 0.025 0.0 0.0 0.0 23 0.0 0.025 0.0 0.0 0.0 24 0.0 0.025 0.0 0.0 0.0 25 0.0 0.025 0.0 0.0 0.0 26 0.0 0.025 0.0 0.0 0.0 27 0.0 0.025 0.0 0.0 0.0 28 0.0 0.025 0.0 0.0 0.0 29 0.0 0.025 0.0 0.0 0.0 30 0.0 0.025 0.0 0.0 0.0 31 0.0 0.025 0.0 0.0 0.0 32 0.0 0.025 0.0 0.0 0.0 33 0.0 0.025 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778968 spots for SRR6322372.sra Written 778968 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra Read 778965 spots for SRR6322372.sra Written 778965 spots for SRR6322372.sra SRR ids: ['SRR6322372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cayjg76m SRR6322372.sra spots: 15579303 blocks: [[1, 778965], [778966, 1557930], [1557931, 2336895], [2336896, 3115860], [3115861, 3894825], [3894826, 4673790], [4673791, 5452755], [5452756, 6231720], [6231721, 7010685], [7010686, 7789650], [7789651, 8568615], [8568616, 9347580], [9347581, 10126545], [10126546, 10905510], [10905511, 11684475], [11684476, 12463440], [12463441, 13242405], [13242406, 14021370], [14021371, 14800335], [14800336, 15579303]] SRR6322372 file size 2704738 SRR6322372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322372 SRR6322372_1.fastq Input file: SRR6322372_1.fastq trimmed: SRR6322372-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:51:18 2024 >> started Sat Dec 7 11:51:30 2024 >> done (11.542s) 15579303 reads processed; of these: 287 ( 0.00%) short reads filtered out after trimming by size control 1258 ( 0.01%) empty reads filtered out after trimming by size control 15577758 (99.99%) reads available; of these: 89806 ( 0.58%) trimmed reads available after processing 15487952 (99.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 48 0.00% 19 64 0.00% 20 104 0.00% 21 141 0.00% 22 212 0.00% 23 512 0.00% 24 399 0.00% 25 575 0.00% 26 718 0.00% 27 832 0.01% 28 883 0.01% 29 1054 0.01% 30 1250 0.01% 31 1875 0.01% 32 3879 0.02% 33 21338 0.14% 34 5939 0.04% 35 749 0.00% 36 492 0.00% 37 519 0.00% 38 518 0.00% 39 611 0.00% 40 760 0.00% 41 948 0.01% 42 1152 0.01% 43 1427 0.01% 44 2011 0.01% 45 2711 0.02% 46 3848 0.02% 47 6102 0.04% 48 10644 0.07% 49 17491 0.11% 50 15487952 99.42% 15577758 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=25 prefix-density=0.00 prefix-fanout=1.0 sequence=TCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=5 fanout-score=7.90 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.2 sequence=ACAACAACAACATGGCGTGTGCCTAGCTCGCAGCACTCATGCACGCAACGCATGCATGCA Started job on | Dec 07 11:51:41 Started mapping on | Dec 07 11:51:43 Finished on | Dec 07 11:52:12 Mapping speed, Million of reads per hour | 1933.79 Number of input reads | 15577758 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 14644062 Uniquely mapped reads % | 94.01% Average mapped length | 49.80 Number of splices: Total | 2064844 Number of splices: Annotated (sjdb) | 1987857 Number of splices: GT/AG | 2038913 Number of splices: GC/AG | 21491 Number of splices: AT/AC | 1233 Number of splices: Non-canonical | 3207 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392369 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 417141 % of reads mapped to too many loci | 2.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541327 541327 541327 N_multimapping 392369 392369 392369 N_noFeature 811925 14316945 913323 N_ambiguous 243159 781 18135 UnstrandedReadsAssigned:13588978 PositiveStrandReadsAssigned:326336 NegativeStrandReadsAssigned:13712604 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322372 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322372-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,577,758 reads, 13,270,662 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR6322372.ke.tsv 35125 SRR6322372.se.tsv 88098 total ==> SRR6322372.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 36.1226 5.54759 PNS24247 1044 945 42.5461 5.78734 PNS24249 1928 1829 22.4755 1.5796 PNS24246 1044 945 42.5461 5.78734 PNS24248 1044 945 42.5461 5.78734 PNS24244 1471 1372 87.7636 8.22264 PNS24243 293 194 0 0 KQK14069 1603 1504 4538.96 387.935 KQK14071 474 375 581.458 199.314 ==> SRR6322372.se.tsv <== BRADI_1g14170v3 6001 BRADI_1g53295v3 289 BRADI_1g59795v3 285 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 1370 BRADI_1g74790v3 321 BRADI_1g09890v3 1 BRADI_1g77505v3 167 BRADI_1g48960v3 0 SRR6322372 completed mapping pipeline successfully