Starting /dee2/code/volunteer_pipeline.sh SRR6322373 current disk space = 1543860338688 free memory = 1597826148 SRR6322373 SRAfilesize f544d13f49ca1966d0c8b379cc4df82b SRR6322373.sra SRR6322373.sra file validated SRR6322373 is single end SRR6322373 is conventional basespace SRR6322373 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.943 34.0 33.0 34.0 27.0 34.0 2 32.685 34.0 33.0 34.0 28.0 34.0 3 32.752 34.0 33.0 34.0 31.0 34.0 4 32.93125 34.0 33.0 34.0 32.0 34.0 5 33.048 34.0 33.0 34.0 32.0 34.0 6 36.86325 38.0 38.0 38.0 35.0 38.0 7 37.133 38.0 38.0 38.0 36.0 38.0 8 37.18625 38.0 38.0 38.0 37.0 38.0 9 37.21225 38.0 38.0 38.0 37.0 38.0 10 37.26875 38.0 38.0 38.0 37.0 38.0 11 37.2525 38.0 38.0 38.0 37.0 38.0 12 37.2215 38.0 38.0 38.0 37.0 38.0 13 37.3105 38.0 38.0 38.0 37.0 38.0 14 37.2735 38.0 38.0 38.0 37.0 38.0 15 37.235 38.0 38.0 38.0 37.0 38.0 16 37.2895 38.0 38.0 38.0 37.0 38.0 17 37.3735 38.0 38.0 38.0 37.0 38.0 18 37.25975 38.0 38.0 38.0 37.0 38.0 19 37.23125 38.0 38.0 38.0 37.0 38.0 20 37.2205 38.0 38.0 38.0 37.0 38.0 21 37.2385 38.0 38.0 38.0 37.0 38.0 22 37.1925 38.0 38.0 38.0 37.0 38.0 23 37.157 38.0 38.0 38.0 36.0 38.0 24 37.18575 38.0 38.0 38.0 37.0 38.0 25 37.1655 38.0 38.0 38.0 37.0 38.0 26 37.26775 38.0 38.0 38.0 37.0 38.0 27 37.149 38.0 38.0 38.0 36.0 38.0 28 37.204 38.0 38.0 38.0 37.0 38.0 29 37.18675 38.0 38.0 38.0 37.0 38.0 30 37.15025 38.0 38.0 38.0 37.0 38.0 31 37.23325 38.0 38.0 38.0 37.0 38.0 32 37.1365 38.0 38.0 38.0 37.0 38.0 33 37.13675 38.0 38.0 38.0 37.0 38.0 34 37.11775 38.0 38.0 38.0 37.0 38.0 35 37.21 38.0 38.0 38.0 37.0 38.0 36 37.1865 38.0 38.0 38.0 36.0 38.0 37 37.13425 38.0 38.0 38.0 36.0 38.0 38 37.12775 38.0 38.0 38.0 36.0 38.0 39 37.0845 38.0 38.0 38.0 36.0 38.0 40 37.16525 38.0 38.0 38.0 36.0 38.0 41 37.1075 38.0 38.0 38.0 36.0 38.0 42 37.16275 38.0 38.0 38.0 36.0 38.0 43 37.17475 38.0 38.0 38.0 37.0 38.0 44 37.15575 38.0 38.0 38.0 36.0 38.0 45 37.06825 38.0 38.0 38.0 36.0 38.0 46 37.12825 38.0 38.0 38.0 37.0 38.0 47 37.1515 38.0 38.0 38.0 37.0 38.0 48 37.005 38.0 38.0 38.0 36.0 38.0 49 37.03725 38.0 38.0 38.0 37.0 38.0 50 37.02175 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 4.0 25 6.0 26 8.0 27 21.0 28 19.0 29 28.0 30 34.0 31 43.0 32 56.0 33 83.0 34 91.0 35 172.0 36 534.0 37 2892.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.28762720942689 8.67702196036422 12.346009641135511 39.68934118907338 2 23.849999999999998 9.975000000000001 32.775 33.4 3 21.625 12.775 23.974999999999998 41.625 4 27.625 16.325 21.725 34.325 5 28.525 22.1 24.575 24.8 6 26.775 26.625 23.05 23.549999999999997 7 20.549999999999997 24.975 34.725 19.75 8 21.9 25.275 28.125 24.7 9 20.125 22.400000000000002 32.875 24.6 10 22.075 32.025 26.625 19.275000000000002 11 25.525 24.125 23.925 26.424999999999997 12 23.474999999999998 23.35 27.6 25.575 13 23.599999999999998 22.625 27.700000000000003 26.075 14 23.025000000000002 24.725 26.474999999999998 25.775 15 23.35 24.15 26.025 26.474999999999998 16 24.075 23.65 24.7 27.575 17 23.150000000000002 24.775 26.525 25.55 18 23.075000000000003 26.1 24.3 26.525 19 23.825 24.725 24.4 27.05 20 23.35 24.474999999999998 25.674999999999997 26.5 21 24.15 24.0 26.05 25.8 22 24.3 25.174999999999997 25.5 25.025 23 23.175 24.775 24.65 27.400000000000002 24 23.025000000000002 24.95 25.650000000000002 26.375 25 24.55 23.0 25.825 26.625 26 23.05 25.7 25.324999999999996 25.924999999999997 27 23.65 25.7 24.25 26.400000000000002 28 24.9 25.15 24.349999999999998 25.6 29 23.425 24.925 25.25 26.400000000000002 30 22.875 25.474999999999998 26.400000000000002 25.25 31 24.375 24.7 25.0 25.924999999999997 32 23.75 24.85 25.374999999999996 26.025 33 23.849999999999998 24.0 24.5 27.650000000000002 34 25.025 24.875 24.25 25.85 35 25.374999999999996 24.75 24.7 25.174999999999997 36 22.900000000000002 25.074999999999996 25.624999999999996 26.400000000000002 37 26.075 24.525 23.775 25.624999999999996 38 23.775 25.724999999999998 25.025 25.474999999999998 39 24.75 25.974999999999998 25.35 23.925 40 24.875 25.174999999999997 24.175 25.775 41 24.825 24.125 24.775 26.275 42 23.400000000000002 26.025 24.7 25.874999999999996 43 24.349999999999998 26.075 23.025000000000002 26.55 44 23.849999999999998 23.925 25.7 26.525 45 25.424999999999997 23.974999999999998 25.2 25.4 46 23.75 24.474999999999998 24.325 27.450000000000003 47 23.375 24.85 25.525 26.25 48 22.95 24.925 25.35 26.775 49 24.925 24.175 24.8 26.1 50 24.125 24.3 25.825 25.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 3.5 24 5.0 25 7.5 26 10.0 27 11.5 28 13.0 29 19.5 30 26.0 31 35.0 32 44.0 33 54.0 34 64.0 35 96.5 36 129.0 37 138.0 38 147.0 39 187.5 40 228.0 41 248.0 42 268.0 43 272.5 44 277.0 45 307.0 46 337.0 47 319.0 48 301.0 49 322.5 50 344.0 51 315.0 52 286.0 53 247.0 54 208.0 55 234.5 56 261.0 57 234.0 58 207.0 59 190.5 60 174.0 61 166.0 62 158.0 63 132.0 64 106.0 65 116.0 66 126.0 67 106.0 68 86.0 69 74.5 70 63.0 71 50.5 72 38.0 73 38.0 74 38.0 75 29.5 76 21.0 77 20.0 78 19.0 79 13.5 80 8.0 81 4.5 82 1.0 83 1.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.025 6 0.0 0.0 0.0 0.0 0.025 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10 0.0 0.0 0.0 0.0 0.025 11 0.0 0.0 0.0 0.0 0.025 12 0.0 0.0 0.0 0.0 0.025 13 0.0 0.0 0.0 0.0 0.025 14 0.0 0.0 0.0 0.0 0.025 15 0.0 0.0 0.0 0.0 0.025 16 0.0 0.0 0.0 0.0 0.025 17 0.0 0.0 0.0 0.0 0.025 18 0.0 0.0 0.0 0.0 0.025 19 0.0 0.0 0.0 0.0 0.025 20 0.0 0.0 0.0 0.0 0.025 21 0.0 0.0 0.0 0.0 0.025 22 0.0 0.0 0.0 0.0 0.025 23 0.0 0.0 0.0 0.0 0.025 24 0.0 0.0 0.0 0.0 0.025 25 0.0 0.0 0.0 0.0 0.025 26 0.0 0.0 0.0 0.0 0.025 27 0.0 0.0 0.0 0.0 0.025 28 0.0 0.0 0.0 0.0 0.025 29 0.0 0.0 0.0 0.0 0.025 30 0.0 0.0 0.0 0.0 0.025 31 0.0 0.0 0.0 0.0 0.025 32 0.0 0.0 0.0 0.0 0.025 33 0.0 0.0 0.0 0.0 0.025 34 0.0 0.0 0.0 0.0 0.025 35 0.0 0.0 0.0 0.0 0.025 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968085 spots for SRR6322373.sra Written 968085 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra Read 968078 spots for SRR6322373.sra Written 968078 spots for SRR6322373.sra SRR ids: ['SRR6322373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r8pio1mk SRR6322373.sra spots: 19361567 blocks: [[1, 968078], [968079, 1936156], [1936157, 2904234], [2904235, 3872312], [3872313, 4840390], [4840391, 5808468], [5808469, 6776546], [6776547, 7744624], [7744625, 8712702], [8712703, 9680780], [9680781, 10648858], [10648859, 11616936], [11616937, 12585014], [12585015, 13553092], [13553093, 14521170], [14521171, 15489248], [15489249, 16457326], [16457327, 17425404], [17425405, 18393482], [18393483, 19361567]] SRR6322373 file size 3363996 SRR6322373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322373 SRR6322373_1.fastq Input file: SRR6322373_1.fastq trimmed: SRR6322373-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:59:50 2024 >> started Sat Dec 7 10:00:04 2024 >> done (13.419s) 19361567 reads processed; of these: 3304 ( 0.02%) short reads filtered out after trimming by size control 15988 ( 0.08%) empty reads filtered out after trimming by size control 19342275 (99.90%) reads available; of these: 128364 ( 0.66%) trimmed reads available after processing 19213911 (99.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 231 0.00% 19 201 0.00% 20 250 0.00% 21 250 0.00% 22 316 0.00% 23 451 0.00% 24 942 0.00% 25 673 0.00% 26 540 0.00% 27 462 0.00% 28 507 0.00% 29 600 0.00% 30 617 0.00% 31 622 0.00% 32 701 0.00% 33 762 0.00% 34 919 0.00% 35 992 0.01% 36 1174 0.01% 37 1289 0.01% 38 1482 0.01% 39 1844 0.01% 40 2106 0.01% 41 2653 0.01% 42 3369 0.02% 43 4340 0.02% 44 5637 0.03% 45 7412 0.04% 46 10495 0.05% 47 15341 0.08% 48 24256 0.13% 49 36930 0.19% 50 19213911 99.34% 19342275 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=14 prefix-density=0.14 prefix-fanout=2.5 sequence=GTTTCTGATCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=79.22 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.8 sequence=CCTTCTCCAGAAGGTGGTAGTCCTCCAGCAGGATGGGCCCCCGGTGGCCCACCGTCAGCGCCTCGTTGTCGTTCCACACCGGTGCGCCGGCGTTGGTCGTCGTGGTCTTCTTGTCGAAGCTGCTCGACGGGCGGTACTTGCAGGGATCCATCTT Started job on | Dec 07 10:00:15 Started mapping on | Dec 07 10:00:15 Finished on | Dec 07 10:00:41 Mapping speed, Million of reads per hour | 2678.16 Number of input reads | 19342275 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18357837 Uniquely mapped reads % | 94.91% Average mapped length | 49.76 Number of splices: Total | 2773207 Number of splices: Annotated (sjdb) | 2653449 Number of splices: GT/AG | 2740074 Number of splices: GC/AG | 26770 Number of splices: AT/AC | 1775 Number of splices: Non-canonical | 4588 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.82 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480049 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 388130 % of reads mapped to too many loci | 2.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 504389 504389 504389 N_multimapping 480049 480049 480049 N_noFeature 798170 17981747 905921 N_ambiguous 287708 944 20812 UnstrandedReadsAssigned:17271959 PositiveStrandReadsAssigned:375146 NegativeStrandReadsAssigned:17431104 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322373 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322373-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,342,275 reads, 17,110,539 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6322373.ke.tsv 35125 SRR6322373.se.tsv 88098 total ==> SRR6322373.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 24.2296 2.89333 PNS24247 1044 945 44.7996 4.73827 PNS24249 1928 1829 27.1759 1.48507 PNS24246 1044 945 44.7996 4.73827 PNS24248 1044 945 44.7996 4.73827 PNS24244 1471 1372 97.1957 7.08061 PNS24243 293 194 0 0 KQK14069 1603 1504 14347.4 953.459 KQK14071 474 375 3901.88 1039.97 ==> SRR6322373.se.tsv <== BRADI_1g14170v3 19544 BRADI_1g53295v3 150 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 3950 BRADI_1g74790v3 121 BRADI_1g09890v3 16 BRADI_1g77505v3 199 BRADI_1g48960v3 0 SRR6322373 completed mapping pipeline successfully