Starting /dee2/code/volunteer_pipeline.sh SRR6322374 current disk space = 1543841251328 free memory = 1598995544 SRR6322374 SRAfilesize c48bd6b3b82ff611d90d1d6d3293de92 SRR6322374.sra SRR6322374.sra file validated SRR6322374 is single end SRR6322374 is conventional basespace SRR6322374 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.168 34.0 33.0 34.0 28.0 34.0 2 32.79025 34.0 33.0 34.0 30.0 34.0 3 32.8525 34.0 33.0 34.0 32.0 34.0 4 32.987 34.0 33.0 34.0 32.0 34.0 5 32.974 34.0 33.0 34.0 32.0 34.0 6 36.847 38.0 38.0 38.0 35.0 38.0 7 37.1355 38.0 38.0 38.0 36.0 38.0 8 37.30675 38.0 38.0 38.0 37.0 38.0 9 37.34675 38.0 38.0 38.0 37.0 38.0 10 37.33575 38.0 38.0 38.0 37.0 38.0 11 37.373 38.0 38.0 38.0 37.0 38.0 12 37.2585 38.0 38.0 38.0 37.0 38.0 13 37.27625 38.0 38.0 38.0 37.0 38.0 14 37.312 38.0 38.0 38.0 37.0 38.0 15 37.3295 38.0 38.0 38.0 37.0 38.0 16 37.3415 38.0 38.0 38.0 37.0 38.0 17 37.28075 38.0 38.0 38.0 37.0 38.0 18 37.329 38.0 38.0 38.0 37.0 38.0 19 37.31 38.0 38.0 38.0 37.0 38.0 20 37.309 38.0 38.0 38.0 37.0 38.0 21 37.32825 38.0 38.0 38.0 37.0 38.0 22 37.268 38.0 38.0 38.0 37.0 38.0 23 37.35725 38.0 38.0 38.0 37.0 38.0 24 37.33275 38.0 38.0 38.0 37.0 38.0 25 37.29375 38.0 38.0 38.0 37.0 38.0 26 37.29525 38.0 38.0 38.0 37.0 38.0 27 37.2755 38.0 38.0 38.0 37.0 38.0 28 37.24525 38.0 38.0 38.0 37.0 38.0 29 37.28125 38.0 38.0 38.0 37.0 38.0 30 37.22975 38.0 38.0 38.0 37.0 38.0 31 37.197 38.0 38.0 38.0 37.0 38.0 32 37.22675 38.0 38.0 38.0 37.0 38.0 33 37.08825 38.0 38.0 38.0 37.0 38.0 34 37.156 38.0 38.0 38.0 37.0 38.0 35 37.221 38.0 38.0 38.0 37.0 38.0 36 37.1945 38.0 38.0 38.0 37.0 38.0 37 37.149 38.0 38.0 38.0 37.0 38.0 38 37.15225 38.0 38.0 38.0 37.0 38.0 39 37.268 38.0 38.0 38.0 37.0 38.0 40 37.205 38.0 38.0 38.0 37.0 38.0 41 37.28225 38.0 38.0 38.0 37.0 38.0 42 37.1925 38.0 38.0 38.0 37.0 38.0 43 37.2305 38.0 38.0 38.0 37.0 38.0 44 37.28225 38.0 38.0 38.0 37.0 38.0 45 37.26 38.0 38.0 38.0 37.0 38.0 46 37.22725 38.0 38.0 38.0 37.0 38.0 47 37.133 38.0 38.0 38.0 36.0 38.0 48 37.1855 38.0 38.0 38.0 37.0 38.0 49 37.1275 38.0 38.0 38.0 37.0 38.0 50 37.186 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.0 24 2.0 25 4.0 26 9.0 27 12.0 28 16.0 29 26.0 30 35.0 31 40.0 32 56.0 33 67.0 34 94.0 35 159.0 36 508.0 37 2963.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75552008512902 10.40170258047353 10.40170258047353 38.441074753923914 2 24.875 10.5 31.3 33.324999999999996 3 21.95 11.700000000000001 24.375 41.975 4 25.8 16.5 22.125 35.575 5 28.249999999999996 20.625 25.525 25.6 6 27.325 25.55 23.775 23.35 7 21.55 24.0 34.849999999999994 19.6 8 23.075000000000003 23.625 29.625 23.674999999999997 9 21.675 23.325000000000003 32.1 22.900000000000002 10 22.85 31.175000000000004 25.825 20.150000000000002 11 25.974999999999998 25.074999999999996 23.225 25.724999999999998 12 23.45 23.599999999999998 26.674999999999997 26.275 13 23.599999999999998 24.2 26.075 26.125 14 23.075000000000003 24.375 26.900000000000002 25.650000000000002 15 22.825 25.025 25.85 26.3 16 24.05 23.724999999999998 25.55 26.674999999999997 17 24.099999999999998 24.9 25.275 25.724999999999998 18 23.525 24.55 26.650000000000002 25.275 19 24.65 23.674999999999997 25.674999999999997 26.0 20 23.95 24.6 25.074999999999996 26.375 21 23.3 23.925 26.525 26.25 22 22.95 24.975 25.0 27.075 23 24.275 23.575 25.35 26.8 24 23.0 25.0 25.1 26.900000000000002 25 23.200000000000003 24.474999999999998 24.3 28.025 26 23.425 24.025 25.85 26.700000000000003 27 24.6 24.675 25.174999999999997 25.55 28 23.525 23.974999999999998 24.925 27.575 29 24.275 24.775 25.124999999999996 25.825 30 23.5 23.625 25.35 27.525 31 23.95 24.625 24.3 27.125 32 24.0 25.025 25.575 25.4 33 24.075 23.549999999999997 24.85 27.525 34 24.625 24.6 24.625 26.150000000000002 35 24.75 24.925 24.025 26.3 36 23.799999999999997 23.925 24.95 27.325 37 23.925 25.3 24.15 26.625 38 24.05 24.625 25.474999999999998 25.85 39 25.2 21.925 26.275 26.6 40 23.95 25.35 22.925 27.775 41 25.0 24.05 24.375 26.575 42 22.2 24.25 24.8 28.749999999999996 43 22.900000000000002 25.275 23.95 27.875 44 23.5 24.7 25.025 26.775 45 23.7 23.7 25.124999999999996 27.474999999999998 46 24.525 24.55 24.3 26.625 47 24.5 24.025 24.85 26.625 48 22.975 24.7 25.2 27.125 49 24.6 24.375 23.625 27.400000000000002 50 25.45 24.15 23.7 26.700000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 2.0 24 4.0 25 4.5 26 5.0 27 10.5 28 16.0 29 23.5 30 31.0 31 40.0 32 49.0 33 64.0 34 79.0 35 87.5 36 96.0 37 124.0 38 152.0 39 181.5 40 211.0 41 239.5 42 268.0 43 272.0 44 276.0 45 299.5 46 323.0 47 320.0 48 317.0 49 308.5 50 300.0 51 280.5 52 261.0 53 254.5 54 248.0 55 234.0 56 220.0 57 212.5 58 205.0 59 199.0 60 193.0 61 174.0 62 155.0 63 145.5 64 136.0 65 122.5 66 109.0 67 105.5 68 102.0 69 95.0 70 88.0 71 69.5 72 51.0 73 46.5 74 42.0 75 34.5 76 27.0 77 20.5 78 14.0 79 13.0 80 12.0 81 9.0 82 6.0 83 3.0 84 0.0 85 1.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39546599496222 98.65 2 0.4785894206549119 0.95 3 0.10075566750629722 0.3 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855991 spots for SRR6322374.sra Written 855991 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra Read 855987 spots for SRR6322374.sra Written 855987 spots for SRR6322374.sra SRR ids: ['SRR6322374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9epwoscf SRR6322374.sra spots: 17119744 blocks: [[1, 855987], [855988, 1711974], [1711975, 2567961], [2567962, 3423948], [3423949, 4279935], [4279936, 5135922], [5135923, 5991909], [5991910, 6847896], [6847897, 7703883], [7703884, 8559870], [8559871, 9415857], [9415858, 10271844], [10271845, 11127831], [11127832, 11983818], [11983819, 12839805], [12839806, 13695792], [13695793, 14551779], [14551780, 15407766], [15407767, 16263753], [16263754, 17119744]] SRR6322374 file size 2973237 SRR6322374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322374 SRR6322374_1.fastq Input file: SRR6322374_1.fastq trimmed: SRR6322374-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:00:48 2024 >> started Sat Dec 7 10:00:56 2024 >> done (8.664s) 17119744 reads processed; of these: 2542 ( 0.01%) short reads filtered out after trimming by size control 6956 ( 0.04%) empty reads filtered out after trimming by size control 17110246 (99.94%) reads available; of these: 116399 ( 0.68%) trimmed reads available after processing 16993847 (99.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 169 0.00% 19 199 0.00% 20 220 0.00% 21 245 0.00% 22 289 0.00% 23 483 0.00% 24 876 0.01% 25 680 0.00% 26 517 0.00% 27 518 0.00% 28 532 0.00% 29 547 0.00% 30 583 0.00% 31 671 0.00% 32 675 0.00% 33 760 0.00% 34 808 0.00% 35 945 0.01% 36 1016 0.01% 37 1193 0.01% 38 1414 0.01% 39 1720 0.01% 40 2105 0.01% 41 2412 0.01% 42 3040 0.02% 43 3894 0.02% 44 5146 0.03% 45 6760 0.04% 46 9248 0.05% 47 13649 0.08% 48 21931 0.13% 49 33154 0.19% 50 16993847 99.32% 17110246 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.15 prefix-fanout=2.0 sequence=CCTGCAGTTGTCGCAGCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=19 fanout-score=11.20 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.8 sequence=CGGTGCCGAAGATGAAGTCCTTGGGGAAGCTGTACCTGCTGAAGGTGGCGCCATGGATGCCGCCGCTGCAGGCTAGCAGCAGAGCGGCGAGCAGGAGGGCG Started job on | Dec 07 10:01:05 Started mapping on | Dec 07 10:01:05 Finished on | Dec 07 10:01:25 Mapping speed, Million of reads per hour | 3079.84 Number of input reads | 17110246 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16228556 Uniquely mapped reads % | 94.85% Average mapped length | 49.75 Number of splices: Total | 2346400 Number of splices: Annotated (sjdb) | 2249507 Number of splices: GT/AG | 2318296 Number of splices: GC/AG | 22780 Number of splices: AT/AC | 1347 Number of splices: Non-canonical | 3977 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453721 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 345977 % of reads mapped to too many loci | 2.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.42% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427969 427969 427969 N_multimapping 453721 453721 453721 N_noFeature 611996 15889423 717195 N_ambiguous 251910 899 18729 UnstrandedReadsAssigned:15364650 PositiveStrandReadsAssigned:338234 NegativeStrandReadsAssigned:15492632 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322374 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322374-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,110,246 reads, 15,239,727 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR6322374.ke.tsv 35125 SRR6322374.se.tsv 88098 total ==> SRR6322374.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.21942 0.0271632 PNS24247 1044 945 88.2106 9.67207 PNS24249 1928 1829 19.3703 1.09737 PNS24246 1044 945 88.2106 9.67207 PNS24248 1044 945 88.2106 9.67207 PNS24244 1471 1372 90.7784 6.85581 PNS24243 293 194 0 0 KQK14069 1603 1504 9274.41 638.952 KQK14071 474 375 1766.98 488.237 ==> SRR6322374.se.tsv <== BRADI_1g14170v3 12100 BRADI_1g53295v3 209 BRADI_1g59795v3 247 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 1012 BRADI_1g74790v3 442 BRADI_1g09890v3 4 BRADI_1g77505v3 120 BRADI_1g48960v3 0 SRR6322374 completed mapping pipeline successfully