Starting /dee2/code/volunteer_pipeline.sh SRR6322375 current disk space = 1543851364352 free memory = 1599349128 SRR6322375 SRAfilesize 8a792f511ad280c306ec4d6a35e4a59e SRR6322375.sra SRR6322375.sra file validated SRR6322375 is single end SRR6322375 is conventional basespace SRR6322375 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.34675 33.0 32.0 34.0 2.0 34.0 2 31.869 33.0 31.0 34.0 27.0 34.0 3 32.21575 34.0 32.0 34.0 27.0 34.0 4 32.69925 34.0 33.0 34.0 32.0 34.0 5 32.83875 34.0 33.0 34.0 32.0 34.0 6 36.76675 38.0 37.0 38.0 34.0 38.0 7 37.1375 38.0 38.0 38.0 36.0 38.0 8 37.22375 38.0 38.0 38.0 36.0 38.0 9 37.31475 38.0 38.0 38.0 37.0 38.0 10 37.35775 38.0 38.0 38.0 37.0 38.0 11 37.31475 38.0 38.0 38.0 37.0 38.0 12 37.326 38.0 38.0 38.0 37.0 38.0 13 37.3405 38.0 38.0 38.0 37.0 38.0 14 37.34975 38.0 38.0 38.0 37.0 38.0 15 37.325 38.0 38.0 38.0 37.0 38.0 16 37.27775 38.0 38.0 38.0 37.0 38.0 17 37.29325 38.0 38.0 38.0 37.0 38.0 18 37.3205 38.0 38.0 38.0 37.0 38.0 19 37.30975 38.0 38.0 38.0 37.0 38.0 20 37.2875 38.0 38.0 38.0 37.0 38.0 21 37.27975 38.0 38.0 38.0 37.0 38.0 22 37.23225 38.0 38.0 38.0 37.0 38.0 23 37.304 38.0 38.0 38.0 37.0 38.0 24 37.289 38.0 38.0 38.0 37.0 38.0 25 37.22275 38.0 38.0 38.0 37.0 38.0 26 37.12575 38.0 38.0 38.0 37.0 38.0 27 37.16875 38.0 38.0 38.0 37.0 38.0 28 37.09125 38.0 38.0 38.0 36.0 38.0 29 37.12225 38.0 38.0 38.0 36.0 38.0 30 37.05625 38.0 38.0 38.0 36.0 38.0 31 37.14425 38.0 38.0 38.0 36.0 38.0 32 37.02375 38.0 38.0 38.0 36.0 38.0 33 37.10525 38.0 38.0 38.0 36.0 38.0 34 37.0895 38.0 38.0 38.0 36.0 38.0 35 37.125 38.0 38.0 38.0 36.0 38.0 36 37.1005 38.0 38.0 38.0 37.0 38.0 37 36.9975 38.0 38.0 38.0 36.0 38.0 38 37.10125 38.0 38.0 38.0 37.0 38.0 39 36.96625 38.0 38.0 38.0 36.0 38.0 40 37.0075 38.0 38.0 38.0 36.0 38.0 41 37.03475 38.0 38.0 38.0 36.0 38.0 42 37.129 38.0 38.0 38.0 37.0 38.0 43 37.0825 38.0 38.0 38.0 37.0 38.0 44 37.11475 38.0 38.0 38.0 37.0 38.0 45 37.04 38.0 38.0 38.0 36.0 38.0 46 37.015 38.0 38.0 38.0 36.0 38.0 47 36.961 38.0 38.0 38.0 36.0 38.0 48 37.0915 38.0 38.0 38.0 37.0 38.0 49 37.11425 38.0 38.0 38.0 37.0 38.0 50 37.13175 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 1.0 20 1.0 21 2.0 22 1.0 23 1.0 24 1.0 25 5.0 26 8.0 27 14.0 28 18.0 29 18.0 30 43.0 31 45.0 32 46.0 33 79.0 34 119.0 35 201.0 36 905.0 37 2482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.91628475404828 9.99083409715857 9.440879926672777 42.652001222120376 2 23.775 13.200000000000001 35.4 27.625 3 22.575 15.275 23.25 38.9 4 26.400000000000002 23.65 21.349999999999998 28.599999999999998 5 27.625 26.5 22.900000000000002 22.975 6 24.474999999999998 29.525000000000002 22.45 23.549999999999997 7 18.675 23.625 36.9 20.8 8 22.3 22.775000000000002 28.4 26.525 9 21.45 21.099999999999998 31.075000000000003 26.375 10 22.650000000000002 33.475 23.825 20.05 11 26.575 23.3 21.925 28.199999999999996 12 25.15 21.65 24.325 28.875 13 23.799999999999997 23.75 26.950000000000003 25.5 14 22.85 24.975 25.25 26.924999999999997 15 22.95 24.325 26.224999999999998 26.5 16 22.425 24.099999999999998 25.374999999999996 28.1 17 24.875 26.200000000000003 24.0 24.925 18 24.525 23.75 25.374999999999996 26.35 19 24.325 24.5 24.8 26.375 20 24.099999999999998 24.2 26.5 25.2 21 25.650000000000002 23.625 24.3 26.424999999999997 22 24.125 25.674999999999997 24.725 25.474999999999998 23 23.35 25.1 24.9 26.650000000000002 24 23.05 23.974999999999998 25.575 27.400000000000002 25 26.275 23.325000000000003 24.325 26.075 26 25.0 23.9 25.2 25.900000000000002 27 23.375 23.825 24.65 28.15 28 24.975 23.599999999999998 24.65 26.775 29 24.65 24.575 23.75 27.025 30 24.975 23.799999999999997 24.925 26.3 31 25.474999999999998 23.724999999999998 23.825 26.974999999999998 32 23.35 24.099999999999998 25.575 26.974999999999998 33 23.425 24.9 24.0 27.675 34 23.974999999999998 24.925 24.2 26.900000000000002 35 24.2 24.875 23.375 27.55 36 24.425 23.825 24.675 27.075 37 24.2 25.324999999999996 24.2 26.275 38 24.099999999999998 25.275 23.575 27.05 39 23.525 23.549999999999997 25.05 27.875 40 25.15 23.65 24.349999999999998 26.85 41 24.5 24.625 24.375 26.5 42 23.575 23.825 25.25 27.35 43 24.625 24.975 23.375 27.025 44 24.425 24.45 25.1 26.025 45 24.075 23.849999999999998 24.4 27.675 46 24.349999999999998 24.875 23.625 27.150000000000002 47 24.875 26.025 23.05 26.05 48 23.9 24.425 24.85 26.825 49 24.099999999999998 24.575 23.974999999999998 27.35 50 23.1 25.275 25.2 26.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 3.0 21 3.5 22 4.0 23 4.5 24 5.0 25 6.5 26 8.0 27 13.5 28 19.0 29 24.5 30 30.0 31 39.5 32 49.0 33 68.5 34 88.0 35 97.0 36 106.0 37 147.5 38 189.0 39 210.5 40 232.0 41 254.0 42 276.0 43 290.5 44 305.0 45 282.0 46 259.0 47 288.5 48 318.0 49 312.5 50 307.0 51 277.0 52 247.0 53 231.0 54 215.0 55 212.0 56 209.0 57 200.0 58 191.0 59 174.5 60 158.0 61 146.0 62 134.0 63 132.0 64 130.0 65 123.0 66 116.0 67 104.5 68 93.0 69 88.0 70 83.0 71 73.0 72 63.0 73 67.0 74 71.0 75 56.5 76 42.0 77 32.0 78 22.0 79 17.0 80 12.0 81 10.5 82 9.0 83 6.5 84 4.0 85 2.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44303797468355 98.2 2 0.40506329113924056 0.8 3 0.025316455696202535 0.075 4 0.0759493670886076 0.3 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 20 0.5 TruSeq Adapter, Index 14 (97% over 44bp) CCCTCACATACGCTATGCACGGCCCCACGGCAGAGTTCACCTGCCCGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485239 spots for SRR6322375.sra Written 1485239 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra Read 1485235 spots for SRR6322375.sra Written 1485235 spots for SRR6322375.sra SRR ids: ['SRR6322375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q9qho7yx SRR6322375.sra spots: 29704704 blocks: [[1, 1485235], [1485236, 2970470], [2970471, 4455705], [4455706, 5940940], [5940941, 7426175], [7426176, 8911410], [8911411, 10396645], [10396646, 11881880], [11881881, 13367115], [13367116, 14852350], [14852351, 16337585], [16337586, 17822820], [17822821, 19308055], [19308056, 20793290], [20793291, 22278525], [22278526, 23763760], [23763761, 25248995], [25248996, 26734230], [26734231, 28219465], [28219466, 29704704]] SRR6322375 file size 5166720 SRR6322375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322375 SRR6322375_1.fastq Input file: SRR6322375_1.fastq trimmed: SRR6322375-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:01:57 2024 >> started Sat Dec 7 10:02:19 2024 >> done (21.767s) 29704704 reads processed; of these: 7836 ( 0.03%) short reads filtered out after trimming by size control 182603 ( 0.61%) empty reads filtered out after trimming by size control 29514265 (99.36%) reads available; of these: 264839 ( 0.90%) trimmed reads available after processing 29249426 (99.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 434 0.00% 19 424 0.00% 20 483 0.00% 21 554 0.00% 22 781 0.00% 23 969 0.00% 24 4676 0.02% 25 3703 0.01% 26 2717 0.01% 27 1992 0.01% 28 1338 0.00% 29 1310 0.00% 30 1455 0.00% 31 1457 0.00% 32 1486 0.01% 33 1623 0.01% 34 1831 0.01% 35 1980 0.01% 36 2298 0.01% 37 2589 0.01% 38 3000 0.01% 39 3577 0.01% 40 4247 0.01% 41 5357 0.02% 42 6851 0.02% 43 8954 0.03% 44 11824 0.04% 45 15809 0.05% 46 21760 0.07% 47 30653 0.10% 48 48101 0.16% 49 70606 0.24% 50 29249426 99.10% 29514265 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=22 prefix-density=0.24 prefix-fanout=1.9 sequence=GGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=145.58 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=12.6 sequence=CGCCGCCGCCAGGCTCTTCACGCCGTTGCAGCACGCCGCCGACGGGGACGCGCCCGTCCCCCTGGCGTAGCTCAGGCACGGCCCCA Started job on | Dec 07 10:03:13 Started mapping on | Dec 07 10:03:13 Finished on | Dec 07 10:03:37 Mapping speed, Million of reads per hour | 4427.14 Number of input reads | 29514265 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 28115804 Uniquely mapped reads % | 95.26% Average mapped length | 49.77 Number of splices: Total | 4108033 Number of splices: Annotated (sjdb) | 3933380 Number of splices: GT/AG | 4054056 Number of splices: GC/AG | 44105 Number of splices: AT/AC | 2562 Number of splices: Non-canonical | 7310 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 743636 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 498327 % of reads mapped to too many loci | 1.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 654825 654825 654825 N_multimapping 743636 743636 743636 N_noFeature 1341066 27337638 1543901 N_ambiguous 654555 1838 79629 UnstrandedReadsAssigned:26120183 PositiveStrandReadsAssigned:776328 NegativeStrandReadsAssigned:26492274 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322375 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322375-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,514,265 reads, 26,228,680 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR6322375.ke.tsv 35125 SRR6322375.se.tsv 88098 total ==> SRR6322375.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 60.8086 4.28267 PNS24247 1044 945 63.0635 3.93388 PNS24249 1928 1829 72.2853 2.32976 PNS24246 1044 945 63.0635 3.93388 PNS24248 1044 945 63.0635 3.93388 PNS24244 1471 1372 110.716 4.75696 PNS24243 293 194 0 0 KQK14069 1603 1504 896.509 35.1384 KQK14071 474 375 400.09 62.8929 ==> SRR6322375.se.tsv <== BRADI_1g14170v3 1425 BRADI_1g53295v3 338 BRADI_1g59795v3 494 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 5895 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 665 BRADI_1g48960v3 0 SRR6322375 completed mapping pipeline successfully