Starting /dee2/code/volunteer_pipeline.sh SRR6322376 current disk space = 1543852552192 free memory = 1602507272 SRR6322376 SRAfilesize fa0e26d662fb68b5df83c8706681df42 SRR6322376.sra SRR6322376.sra file validated SRR6322376 is single end SRR6322376 is conventional basespace SRR6322376 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.39225 34.0 33.0 34.0 30.0 34.0 2 32.6825 34.0 33.0 34.0 28.0 34.0 3 32.772 34.0 33.0 34.0 31.0 34.0 4 32.8365 34.0 33.0 34.0 32.0 34.0 5 32.8795 34.0 33.0 34.0 32.0 34.0 6 36.666 38.0 37.0 38.0 34.0 38.0 7 36.9655 38.0 38.0 38.0 36.0 38.0 8 37.0635 38.0 38.0 38.0 36.0 38.0 9 37.1995 38.0 38.0 38.0 37.0 38.0 10 37.176 38.0 38.0 38.0 37.0 38.0 11 37.19775 38.0 38.0 38.0 37.0 38.0 12 37.10325 38.0 38.0 38.0 36.0 38.0 13 37.22525 38.0 38.0 38.0 37.0 38.0 14 37.06475 38.0 38.0 38.0 36.0 38.0 15 37.12475 38.0 38.0 38.0 36.0 38.0 16 37.1125 38.0 38.0 38.0 36.0 38.0 17 37.1165 38.0 38.0 38.0 36.0 38.0 18 37.11825 38.0 38.0 38.0 37.0 38.0 19 37.10475 38.0 38.0 38.0 37.0 38.0 20 37.17525 38.0 38.0 38.0 37.0 38.0 21 37.10825 38.0 38.0 38.0 37.0 38.0 22 37.15075 38.0 38.0 38.0 37.0 38.0 23 37.00425 38.0 38.0 38.0 36.0 38.0 24 37.048 38.0 38.0 38.0 36.0 38.0 25 37.08725 38.0 38.0 38.0 36.0 38.0 26 37.01175 38.0 38.0 38.0 36.0 38.0 27 37.11175 38.0 38.0 38.0 36.0 38.0 28 37.06725 38.0 38.0 38.0 37.0 38.0 29 37.1195 38.0 38.0 38.0 37.0 38.0 30 37.016 38.0 38.0 38.0 36.0 38.0 31 37.07475 38.0 38.0 38.0 36.0 38.0 32 37.007 38.0 38.0 38.0 36.0 38.0 33 37.0285 38.0 38.0 38.0 36.0 38.0 34 36.96425 38.0 38.0 38.0 36.0 38.0 35 37.0245 38.0 38.0 38.0 36.0 38.0 36 37.00575 38.0 38.0 38.0 36.0 38.0 37 37.009 38.0 38.0 38.0 36.0 38.0 38 37.01875 38.0 38.0 38.0 36.0 38.0 39 36.99375 38.0 38.0 38.0 36.0 38.0 40 37.03425 38.0 38.0 38.0 36.0 38.0 41 36.98 38.0 38.0 38.0 36.0 38.0 42 37.03025 38.0 38.0 38.0 36.0 38.0 43 36.96825 38.0 38.0 38.0 36.0 38.0 44 36.933 38.0 38.0 38.0 36.0 38.0 45 36.94025 38.0 38.0 38.0 36.0 38.0 46 36.99225 38.0 38.0 38.0 36.0 38.0 47 36.9725 38.0 38.0 38.0 36.0 38.0 48 36.94825 38.0 38.0 38.0 36.0 38.0 49 36.92475 38.0 38.0 38.0 36.0 38.0 50 36.887 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 2.0 23 4.0 24 4.0 25 9.0 26 13.0 27 9.0 28 33.0 29 31.0 30 25.0 31 33.0 32 62.0 33 78.0 34 119.0 35 171.0 36 521.0 37 2870.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.14398525927876 11.081863648328508 9.607791524085286 32.16635956830745 2 23.425 11.525 31.175000000000004 33.875 3 21.43035758939735 16.30407601900475 25.156289072268066 37.109277319329834 4 25.45 19.15 24.2 31.2 5 26.575 24.325 24.575 24.525 6 24.425 27.925 24.7 22.95 7 20.45 24.325 33.75 21.475 8 22.325 25.0 28.549999999999997 24.125 9 22.625 22.575 31.3 23.5 10 22.7 31.55 23.775 21.975 11 25.650000000000002 23.95 23.025000000000002 27.375 12 24.3 20.599999999999998 25.724999999999998 29.375 13 23.05 23.625 27.325 26.0 14 23.375 23.849999999999998 27.200000000000003 25.575 15 23.9 23.625 26.625 25.85 16 24.099999999999998 24.375 24.425 27.1 17 24.825 24.224999999999998 25.75 25.2 18 24.224999999999998 24.625 24.625 26.525 19 23.849999999999998 23.9 25.7 26.55 20 22.45 24.7 25.874999999999996 26.974999999999998 21 23.075000000000003 25.1 26.275 25.55 22 24.775 23.400000000000002 25.7 26.125 23 23.0 24.95 25.3 26.75 24 23.799999999999997 23.549999999999997 25.174999999999997 27.474999999999998 25 24.975 23.200000000000003 24.25 27.575 26 24.125 25.35 24.975 25.55 27 24.3 23.375 25.525 26.8 28 24.675 25.2 23.875 26.25 29 24.525 24.224999999999998 25.324999999999996 25.924999999999997 30 23.875 24.625 25.124999999999996 26.375 31 23.9 24.8 24.325 26.974999999999998 32 23.65 25.025 24.775 26.55 33 23.825 23.65 25.900000000000002 26.625 34 23.75 24.95 24.725 26.575 35 23.775 24.8 25.1 26.325 36 25.424999999999997 22.925 25.45 26.200000000000003 37 25.474999999999998 23.7 24.099999999999998 26.724999999999998 38 22.275 25.525 25.924999999999997 26.275 39 24.8 24.2 25.15 25.85 40 24.65 24.425 24.5 26.424999999999997 41 23.599999999999998 24.85 23.974999999999998 27.575 42 22.825 25.374999999999996 24.4 27.400000000000002 43 24.25 24.05 25.224999999999998 26.474999999999998 44 23.474999999999998 24.425 26.625 25.474999999999998 45 22.900000000000002 23.974999999999998 25.95 27.175 46 24.625 23.7 24.099999999999998 27.575 47 22.925 25.825 24.875 26.375 48 24.575 23.95 24.9 26.575 49 25.275 24.55 23.775 26.400000000000002 50 23.200000000000003 25.650000000000002 24.3 26.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 4.0 25 5.5 26 7.0 27 9.5 28 12.0 29 21.5 30 31.0 31 41.0 32 51.0 33 55.5 34 60.0 35 86.0 36 112.0 37 133.0 38 154.0 39 188.0 40 222.0 41 243.0 42 264.0 43 289.5 44 315.0 45 321.5 46 328.0 47 327.0 48 326.0 49 325.5 50 325.0 51 285.0 52 245.0 53 235.0 54 225.0 55 216.5 56 208.0 57 200.0 58 192.0 59 179.5 60 167.0 61 161.5 62 156.0 63 151.5 64 147.0 65 128.0 66 109.0 67 104.0 68 99.0 69 89.0 70 79.0 71 67.5 72 56.0 73 48.5 74 41.0 75 34.5 76 28.0 77 21.0 78 14.0 79 14.5 80 15.0 81 8.0 82 1.0 83 0.5 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44783715012723 96.72500000000001 2 1.3740458015267176 2.7 3 0.1272264631043257 0.375 4 0.05089058524173028 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025257 spots for SRR6322376.sra Written 1025257 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra Read 1025253 spots for SRR6322376.sra Written 1025253 spots for SRR6322376.sra SRR ids: ['SRR6322376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rmt9t1p7 SRR6322376.sra spots: 20505064 blocks: [[1, 1025253], [1025254, 2050506], [2050507, 3075759], [3075760, 4101012], [4101013, 5126265], [5126266, 6151518], [6151519, 7176771], [7176772, 8202024], [8202025, 9227277], [9227278, 10252530], [10252531, 11277783], [11277784, 12303036], [12303037, 13328289], [13328290, 14353542], [14353543, 15378795], [15378796, 16404048], [16404049, 17429301], [17429302, 18454554], [18454555, 19479807], [19479808, 20505064]] SRR6322376 file size 3563287 SRR6322376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322376 SRR6322376_1.fastq Input file: SRR6322376_1.fastq trimmed: SRR6322376-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:02:45 2024 >> started Sat Dec 7 10:02:59 2024 >> done (13.575s) 20505064 reads processed; of these: 8300 ( 0.04%) short reads filtered out after trimming by size control 42565 ( 0.21%) empty reads filtered out after trimming by size control 20454199 (99.75%) reads available; of these: 188118 ( 0.92%) trimmed reads available after processing 20266081 (99.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 537 0.00% 19 564 0.00% 20 638 0.00% 21 709 0.00% 22 882 0.00% 23 1358 0.01% 24 1260 0.01% 25 1227 0.01% 26 1449 0.01% 27 1215 0.01% 28 1279 0.01% 29 1312 0.01% 30 1272 0.01% 31 1404 0.01% 32 1540 0.01% 33 1570 0.01% 34 1688 0.01% 35 1835 0.01% 36 2057 0.01% 37 2290 0.01% 38 2634 0.01% 39 2974 0.01% 40 3612 0.02% 41 4178 0.02% 42 5322 0.03% 43 6515 0.03% 44 8336 0.04% 45 11057 0.05% 46 14677 0.07% 47 21467 0.10% 48 33317 0.16% 49 47943 0.23% 50 20266081 99.08% 20454199 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=22 prefix-density=0.51 prefix-fanout=2.0 sequence=TCCACGCTTTTGGGGATGGAGACGAAGGTTCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=8.41 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.4 sequence=CACCACGCGGCCCGACGACGGCAGGAGCTCATCGTCCATCGGGGTGTACCGGGACGCGAAGAGCTGCAGCGTGTGGCCAAGGATGTTGCCGCTCCCTTTCCCTCCCAGGTTCCAGTACGTGTGCTGCAGGAAGTTCACCGGCGTGGCCTTGTTCAGCGCCGTCGCGTTCGTGCGGATGCTCAGCACGTACGGGCTCGACAGGCTGTACGTCGCGTACACGTCCAGGTCTCCGGGGAATCCTTGCTCTCCATCGAAGCTGCGGTAGTACAGAGTGATGTGTGGGGAGTCGCCGCCACCAACGTATTCCTTCACCGTCCATATCACCTTGCTGAATCCCCTGTGACCACCATGAATTGCATTCCTGCCGTCGTTGATGTACGTATGGTACACTTTGCCGTCGAGGACGAATCGGCCCCTAGCCATTCTTTGCGCCACGCGCCCGGTCAGTGGCCCAAAGTAAGAGGTGTCGTTAACATATTCAGCGAGGGTGTCTTTACCCAGCACAACATCG Started job on | Dec 07 10:03:14 Started mapping on | Dec 07 10:03:15 Finished on | Dec 07 10:03:33 Mapping speed, Million of reads per hour | 4090.84 Number of input reads | 20454199 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 19283781 Uniquely mapped reads % | 94.28% Average mapped length | 49.75 Number of splices: Total | 2644835 Number of splices: Annotated (sjdb) | 2561993 Number of splices: GT/AG | 2610356 Number of splices: GC/AG | 27733 Number of splices: AT/AC | 950 Number of splices: Non-canonical | 5796 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.49 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 775210 % of reads mapped to multiple loci | 3.79% Number of reads mapped to too many loci | 300688 % of reads mapped to too many loci | 1.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395208 395208 395208 N_multimapping 775210 775210 775210 N_noFeature 825361 18846699 979476 N_ambiguous 296388 659 13808 UnstrandedReadsAssigned:18162032 PositiveStrandReadsAssigned:436423 NegativeStrandReadsAssigned:18290497 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322376 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322376-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,454,199 reads, 18,145,273 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6322376.ke.tsv 35125 SRR6322376.se.tsv 88098 total ==> SRR6322376.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 163.583 18.199 PNS24247 1044 945 69.9075 6.88854 PNS24249 1928 1829 34.8964 1.77665 PNS24246 1044 945 69.9075 6.88854 PNS24248 1044 945 69.9075 6.88854 PNS24244 1471 1372 279.798 18.99 PNS24243 293 194 0 0 KQK14069 1603 1504 2754.89 170.565 KQK14071 474 375 688.029 170.848 ==> SRR6322376.se.tsv <== BRADI_1g14170v3 3786 BRADI_1g53295v3 134 BRADI_1g59795v3 112 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 2389 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 64 BRADI_1g48960v3 1 SRR6322376 completed mapping pipeline successfully