Starting /dee2/code/volunteer_pipeline.sh SRR6322377 current disk space = 1543118434304 free memory = 1603145116 SRR6322377 SRAfilesize e8479f796b39996fd0577e8aa43a30ea SRR6322377.sra SRR6322377.sra file validated SRR6322377 is single end SRR6322377 is conventional basespace SRR6322377 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5595 34.0 33.0 34.0 31.0 34.0 2 32.72075 34.0 33.0 34.0 30.0 34.0 3 32.88775 34.0 33.0 34.0 32.0 34.0 4 32.93325 34.0 33.0 34.0 32.0 34.0 5 32.94225 34.0 33.0 34.0 32.0 34.0 6 36.77875 38.0 38.0 38.0 35.0 38.0 7 37.107 38.0 38.0 38.0 36.0 38.0 8 37.09875 38.0 38.0 38.0 36.0 38.0 9 37.1625 38.0 38.0 38.0 36.0 38.0 10 37.1845 38.0 38.0 38.0 37.0 38.0 11 37.23425 38.0 38.0 38.0 37.0 38.0 12 37.1145 38.0 38.0 38.0 37.0 38.0 13 37.0975 38.0 38.0 38.0 37.0 38.0 14 37.16625 38.0 38.0 38.0 37.0 38.0 15 37.16275 38.0 38.0 38.0 36.0 38.0 16 37.14925 38.0 38.0 38.0 36.0 38.0 17 37.1955 38.0 38.0 38.0 37.0 38.0 18 37.20025 38.0 38.0 38.0 37.0 38.0 19 37.19975 38.0 38.0 38.0 37.0 38.0 20 37.23375 38.0 38.0 38.0 36.0 38.0 21 37.13425 38.0 38.0 38.0 36.0 38.0 22 37.194 38.0 38.0 38.0 37.0 38.0 23 37.183 38.0 38.0 38.0 37.0 38.0 24 37.24025 38.0 38.0 38.0 37.0 38.0 25 37.124 38.0 38.0 38.0 37.0 38.0 26 37.165 38.0 38.0 38.0 37.0 38.0 27 37.2085 38.0 38.0 38.0 36.0 38.0 28 37.16825 38.0 38.0 38.0 37.0 38.0 29 37.123 38.0 38.0 38.0 36.0 38.0 30 37.1075 38.0 38.0 38.0 36.0 38.0 31 37.129 38.0 38.0 38.0 36.0 38.0 32 37.08825 38.0 38.0 38.0 37.0 38.0 33 37.15475 38.0 38.0 38.0 37.0 38.0 34 37.0205 38.0 38.0 38.0 36.0 38.0 35 37.06075 38.0 38.0 38.0 36.0 38.0 36 37.09575 38.0 38.0 38.0 36.0 38.0 37 37.0985 38.0 38.0 38.0 36.0 38.0 38 37.1165 38.0 38.0 38.0 36.0 38.0 39 37.0695 38.0 38.0 38.0 36.0 38.0 40 37.1015 38.0 38.0 38.0 36.0 38.0 41 37.055 38.0 38.0 38.0 36.0 38.0 42 37.03225 38.0 38.0 38.0 36.0 38.0 43 37.07975 38.0 38.0 38.0 36.0 38.0 44 37.148 38.0 38.0 38.0 37.0 38.0 45 37.0515 38.0 38.0 38.0 36.0 38.0 46 37.09875 38.0 38.0 38.0 36.0 38.0 47 37.0675 38.0 38.0 38.0 36.0 38.0 48 37.04475 38.0 38.0 38.0 36.0 38.0 49 37.02825 38.0 38.0 38.0 36.0 38.0 50 36.97475 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 2.0 23 2.0 24 2.0 25 9.0 26 17.0 27 14.0 28 20.0 29 22.0 30 43.0 31 60.0 32 41.0 33 67.0 34 96.0 35 199.0 36 527.0 37 2871.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.147205457885065 10.495932826029913 7.557071634741537 32.799790081343474 2 23.275000000000002 11.4 34.275 31.05 3 20.485242621310658 15.982991495747875 28.039019509754876 35.4927463731866 4 26.424999999999997 23.35 21.475 28.749999999999996 5 25.45 27.425 24.925 22.2 6 22.45 31.3 23.200000000000003 23.05 7 18.775 24.2 37.95 19.075 8 19.575 25.45 29.425 25.55 9 20.125 22.0 31.2 26.674999999999997 10 20.275000000000002 35.15 25.174999999999997 19.400000000000002 11 24.425 26.0 23.0 26.575 12 21.85 23.45 26.875 27.825 13 23.625 25.900000000000002 27.375 23.1 14 21.8 26.025 27.6 24.575 15 21.675 25.1 26.575 26.650000000000002 16 23.025000000000002 27.3 25.174999999999997 24.5 17 23.175 26.325 26.224999999999998 24.275 18 22.7 26.3 25.650000000000002 25.35 19 22.2 26.0 26.3 25.5 20 21.325 27.55 26.825 24.3 21 22.95 26.224999999999998 25.15 25.674999999999997 22 21.9 26.275 26.174999999999997 25.650000000000002 23 21.5 26.474999999999998 27.125 24.9 24 21.9 24.575 26.325 27.200000000000003 25 22.75 25.45 26.224999999999998 25.575 26 21.5 26.575 27.450000000000003 24.474999999999998 27 22.525000000000002 24.875 26.950000000000003 25.650000000000002 28 22.8 27.0 26.900000000000002 23.3 29 23.075000000000003 26.375 25.474999999999998 25.074999999999996 30 21.349999999999998 25.224999999999998 26.674999999999997 26.75 31 23.549999999999997 26.875 25.124999999999996 24.45 32 22.5 27.1 25.0 25.4 33 23.150000000000002 25.6 26.400000000000002 24.85 34 23.799999999999997 26.025 25.124999999999996 25.05 35 22.650000000000002 25.7 26.0 25.650000000000002 36 22.225 26.775 26.5 24.5 37 21.975 26.75 26.075 25.2 38 22.5 25.95 26.474999999999998 25.074999999999996 39 22.925 25.374999999999996 25.924999999999997 25.775 40 23.200000000000003 25.85 25.825 25.124999999999996 41 22.375 26.325 26.3 25.0 42 22.125 25.1 26.474999999999998 26.3 43 22.475 27.625 25.224999999999998 24.675 44 23.275000000000002 26.55 24.975 25.2 45 21.875 25.35 26.3 26.474999999999998 46 21.349999999999998 27.325 24.95 26.375 47 21.7 26.724999999999998 25.7 25.874999999999996 48 22.175 26.0 26.424999999999997 25.4 49 21.5 27.375 25.174999999999997 25.95 50 23.375 26.724999999999998 25.525 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 3.5 22 5.0 23 5.0 24 5.0 25 7.0 26 9.0 27 17.5 28 26.0 29 32.5 30 39.0 31 46.5 32 54.0 33 68.5 34 83.0 35 104.5 36 126.0 37 176.0 38 226.0 39 252.0 40 278.0 41 301.0 42 324.0 43 344.5 44 365.0 45 360.5 46 356.0 47 346.5 48 337.0 49 339.5 50 342.0 51 310.0 52 278.0 53 268.0 54 258.0 55 223.0 56 188.0 57 179.5 58 171.0 59 157.5 60 144.0 61 126.5 62 109.0 63 96.0 64 83.0 65 71.5 66 60.0 67 49.0 68 38.0 69 33.0 70 28.0 71 26.0 72 24.0 73 22.0 74 20.0 75 15.5 76 11.0 77 9.5 78 8.0 79 4.5 80 1.0 81 1.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014468 spots for SRR6322377.sra Written 1014468 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra Read 1014450 spots for SRR6322377.sra Written 1014450 spots for SRR6322377.sra SRR ids: ['SRR6322377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qer7frsx SRR6322377.sra spots: 20289018 blocks: [[1, 1014450], [1014451, 2028900], [2028901, 3043350], [3043351, 4057800], [4057801, 5072250], [5072251, 6086700], [6086701, 7101150], [7101151, 8115600], [8115601, 9130050], [9130051, 10144500], [10144501, 11158950], [11158951, 12173400], [12173401, 13187850], [13187851, 14202300], [14202301, 15216750], [15216751, 16231200], [16231201, 17245650], [17245651, 18260100], [18260101, 19274550], [19274551, 20289018]] SRR6322377 file size 3525634 SRR6322377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322377 SRR6322377_1.fastq Input file: SRR6322377_1.fastq trimmed: SRR6322377-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:51:41 2024 >> started Sat Dec 7 11:52:20 2024 >> done (38.875s) 20289018 reads processed; of these: 4134 ( 0.02%) short reads filtered out after trimming by size control 8734 ( 0.04%) empty reads filtered out after trimming by size control 20276150 (99.94%) reads available; of these: 131924 ( 0.65%) trimmed reads available after processing 20144226 (99.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 290 0.00% 19 286 0.00% 20 268 0.00% 21 354 0.00% 22 409 0.00% 23 817 0.00% 24 665 0.00% 25 678 0.00% 26 770 0.00% 27 618 0.00% 28 681 0.00% 29 663 0.00% 30 698 0.00% 31 760 0.00% 32 822 0.00% 33 904 0.00% 34 1030 0.01% 35 1095 0.01% 36 1310 0.01% 37 1455 0.01% 38 1794 0.01% 39 2001 0.01% 40 2393 0.01% 41 2989 0.01% 42 3659 0.02% 43 4764 0.02% 44 5994 0.03% 45 8017 0.04% 46 10698 0.05% 47 15702 0.08% 48 24206 0.12% 49 35134 0.17% 50 20144226 99.35% 20276150 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=18 prefix-density=0.31 prefix-fanout=1.9 sequence=GGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=21.30 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=CGCCGCCGCCGCGGTAGTAGTCCTGCACGTCCACCTTGCTCTCCTCCTCCTTCTTCTTGCCCTGAGTTTCTTCGGCGGCGGAGACGAGTAAAGCAGCAGCA Started job on | Dec 07 11:52:30 Started mapping on | Dec 07 11:52:31 Finished on | Dec 07 11:52:47 Mapping speed, Million of reads per hour | 4562.13 Number of input reads | 20276150 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 19325258 Uniquely mapped reads % | 95.31% Average mapped length | 49.78 Number of splices: Total | 2988119 Number of splices: Annotated (sjdb) | 2887009 Number of splices: GT/AG | 2949755 Number of splices: GC/AG | 31308 Number of splices: AT/AC | 2127 Number of splices: Non-canonical | 4929 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 547549 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 314677 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 403343 403343 403343 N_multimapping 547549 547549 547549 N_noFeature 1106794 18770913 1227254 N_ambiguous 474423 1458 40963 UnstrandedReadsAssigned:17744041 PositiveStrandReadsAssigned:552887 NegativeStrandReadsAssigned:18057041 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322377 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322377-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,276,150 reads, 17,782,308 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR6322377.ke.tsv 35125 SRR6322377.se.tsv 88098 total ==> SRR6322377.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 42.1887 4.50205 PNS24249 1928 1829 3.93373 0.216888 PNS24246 1044 945 42.1887 4.50205 PNS24248 1044 945 42.1887 4.50205 PNS24244 1471 1372 172.5 12.6789 PNS24243 293 194 0 0 KQK14069 1603 1504 306.998 20.5842 KQK14071 474 375 55.4683 14.9163 ==> SRR6322377.se.tsv <== BRADI_1g14170v3 468 BRADI_1g53295v3 196 BRADI_1g59795v3 676 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 4599 BRADI_1g74790v3 31 BRADI_1g09890v3 0 BRADI_1g77505v3 506 BRADI_1g48960v3 0 SRR6322377 completed mapping pipeline successfully