Starting /dee2/code/volunteer_pipeline.sh SRR6322378 current disk space = 1543765245952 free memory = 1598349760 SRR6322378 SRAfilesize 59bcd3aa12acff9545fbc67530297b7b SRR6322378.sra SRR6322378.sra file validated SRR6322378 is single end SRR6322378 is conventional basespace SRR6322378 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9305 34.0 33.0 34.0 25.0 34.0 2 32.6305 34.0 33.0 34.0 28.0 34.0 3 32.76475 34.0 33.0 34.0 31.0 34.0 4 32.962 34.0 33.0 34.0 32.0 34.0 5 33.016 34.0 33.0 34.0 32.0 34.0 6 36.8585 38.0 38.0 38.0 35.0 38.0 7 37.10775 38.0 38.0 38.0 36.0 38.0 8 37.18725 38.0 38.0 38.0 37.0 38.0 9 37.28225 38.0 38.0 38.0 37.0 38.0 10 37.27675 38.0 38.0 38.0 37.0 38.0 11 37.3415 38.0 38.0 38.0 37.0 38.0 12 37.326 38.0 38.0 38.0 37.0 38.0 13 37.255 38.0 38.0 38.0 37.0 38.0 14 37.32525 38.0 38.0 38.0 37.0 38.0 15 37.3135 38.0 38.0 38.0 37.0 38.0 16 37.2745 38.0 38.0 38.0 37.0 38.0 17 37.2455 38.0 38.0 38.0 37.0 38.0 18 37.26175 38.0 38.0 38.0 37.0 38.0 19 37.2535 38.0 38.0 38.0 37.0 38.0 20 37.32975 38.0 38.0 38.0 37.0 38.0 21 37.3305 38.0 38.0 38.0 37.0 38.0 22 37.2625 38.0 38.0 38.0 37.0 38.0 23 37.29975 38.0 38.0 38.0 37.0 38.0 24 37.28725 38.0 38.0 38.0 37.0 38.0 25 37.28675 38.0 38.0 38.0 37.0 38.0 26 37.28125 38.0 38.0 38.0 37.0 38.0 27 37.29725 38.0 38.0 38.0 37.0 38.0 28 37.30675 38.0 38.0 38.0 37.0 38.0 29 37.30275 38.0 38.0 38.0 37.0 38.0 30 37.29225 38.0 38.0 38.0 37.0 38.0 31 37.3025 38.0 38.0 38.0 37.0 38.0 32 37.3325 38.0 38.0 38.0 37.0 38.0 33 37.23725 38.0 38.0 38.0 37.0 38.0 34 37.21825 38.0 38.0 38.0 37.0 38.0 35 37.29825 38.0 38.0 38.0 37.0 38.0 36 37.241 38.0 38.0 38.0 37.0 38.0 37 37.2165 38.0 38.0 38.0 37.0 38.0 38 37.208 38.0 38.0 38.0 37.0 38.0 39 37.245 38.0 38.0 38.0 37.0 38.0 40 37.236 38.0 38.0 38.0 37.0 38.0 41 37.2215 38.0 38.0 38.0 37.0 38.0 42 37.215 38.0 38.0 38.0 37.0 38.0 43 37.1495 38.0 38.0 38.0 37.0 38.0 44 37.238 38.0 38.0 38.0 37.0 38.0 45 37.17875 38.0 38.0 38.0 37.0 38.0 46 37.1945 38.0 38.0 38.0 37.0 38.0 47 37.17975 38.0 38.0 38.0 37.0 38.0 48 37.15325 38.0 38.0 38.0 37.0 38.0 49 37.19125 38.0 38.0 38.0 37.0 38.0 50 37.165 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 5.0 25 2.0 26 7.0 27 19.0 28 23.0 29 30.0 30 21.0 31 47.0 32 40.0 33 72.0 34 98.0 35 154.0 36 508.0 37 2967.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.76853090714477 10.48969761841049 8.054589242708055 36.687182231736685 2 23.9 10.875 33.175 32.05 3 21.325 13.275 26.200000000000003 39.2 4 25.924999999999997 18.925 24.0 31.15 5 27.325 23.849999999999998 24.025 24.8 6 24.5 27.6 24.075 23.825 7 19.1 25.3 36.75 18.85 8 21.275 24.25 30.075000000000003 24.4 9 19.2 22.375 33.5 24.925 10 20.75 33.7 26.650000000000002 18.9 11 24.525 24.525 24.8 26.150000000000002 12 24.075 22.275 27.625 26.025 13 22.5 25.825 27.025 24.65 14 22.075 25.35 28.925 23.65 15 22.375 24.25 26.5 26.875 16 22.475 26.150000000000002 25.624999999999996 25.75 17 22.75 25.525 25.924999999999997 25.8 18 22.55 25.95 25.95 25.55 19 23.65 25.0 26.575 24.775 20 23.525 25.7 26.424999999999997 24.349999999999998 21 23.325000000000003 25.5 25.224999999999998 25.95 22 23.325000000000003 25.0 25.900000000000002 25.775 23 23.3 25.45 26.525 24.725 24 23.875 25.75 23.9 26.474999999999998 25 22.675 25.75 26.55 25.025 26 23.1 25.6 25.75 25.55 27 23.525 25.474999999999998 25.074999999999996 25.924999999999997 28 22.7 24.2 26.724999999999998 26.375 29 22.975 25.85 25.525 25.650000000000002 30 23.200000000000003 24.975 25.825 26.0 31 23.1 25.374999999999996 25.4 26.125 32 22.975 25.474999999999998 26.650000000000002 24.9 33 23.525 23.9 25.074999999999996 27.500000000000004 34 23.625 25.45 24.75 26.174999999999997 35 23.150000000000002 25.650000000000002 25.1 26.1 36 22.15 24.725 27.224999999999998 25.900000000000002 37 22.575 26.025 25.474999999999998 25.924999999999997 38 23.799999999999997 25.650000000000002 25.8 24.75 39 25.2 23.625 25.5 25.674999999999997 40 24.575 25.174999999999997 25.2 25.05 41 21.4 26.525 26.1 25.974999999999998 42 22.75 24.25 25.7 27.3 43 23.799999999999997 26.85 24.25 25.1 44 23.75 25.374999999999996 26.625 24.25 45 22.875 25.275 25.75 26.1 46 23.625 25.025 24.95 26.400000000000002 47 23.95 26.25 25.724999999999998 24.075 48 23.7 24.525 26.400000000000002 25.374999999999996 49 24.325 24.675 25.424999999999997 25.575 50 22.775000000000002 26.625 25.85 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 4.0 24 8.0 25 9.0 26 10.0 27 11.5 28 13.0 29 17.5 30 22.0 31 32.0 32 42.0 33 66.5 34 91.0 35 104.0 36 117.0 37 145.5 38 174.0 39 198.0 40 222.0 41 263.0 42 304.0 43 314.0 44 324.0 45 343.5 46 363.0 47 363.5 48 364.0 49 363.5 50 363.0 51 328.0 52 293.0 53 279.0 54 265.0 55 238.5 56 212.0 57 194.5 58 177.0 59 167.0 60 157.0 61 140.5 62 124.0 63 114.0 64 104.0 65 95.0 66 86.0 67 68.0 68 50.0 69 46.0 70 42.0 71 38.0 72 34.0 73 25.0 74 16.0 75 12.5 76 9.0 77 7.0 78 5.0 79 5.5 80 6.0 81 3.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875387 spots for SRR6322378.sra Written 875387 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra Read 875383 spots for SRR6322378.sra Written 875383 spots for SRR6322378.sra SRR ids: ['SRR6322378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kleqr76x SRR6322378.sra spots: 17507664 blocks: [[1, 875383], [875384, 1750766], [1750767, 2626149], [2626150, 3501532], [3501533, 4376915], [4376916, 5252298], [5252299, 6127681], [6127682, 7003064], [7003065, 7878447], [7878448, 8753830], [8753831, 9629213], [9629214, 10504596], [10504597, 11379979], [11379980, 12255362], [12255363, 13130745], [13130746, 14006128], [14006129, 14881511], [14881512, 15756894], [15756895, 16632277], [16632278, 17507664]] SRR6322378 file size 3040854 SRR6322378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322378 SRR6322378_1.fastq Input file: SRR6322378_1.fastq trimmed: SRR6322378-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:04:37 2024 >> started Sat Dec 7 10:04:53 2024 >> done (15.961s) 17507664 reads processed; of these: 2689 ( 0.02%) short reads filtered out after trimming by size control 7026 ( 0.04%) empty reads filtered out after trimming by size control 17497949 (99.94%) reads available; of these: 104950 ( 0.60%) trimmed reads available after processing 17392999 (99.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 157 0.00% 19 163 0.00% 20 194 0.00% 21 213 0.00% 22 265 0.00% 23 385 0.00% 24 759 0.00% 25 589 0.00% 26 434 0.00% 27 396 0.00% 28 453 0.00% 29 439 0.00% 30 528 0.00% 31 549 0.00% 32 633 0.00% 33 668 0.00% 34 730 0.00% 35 847 0.00% 36 933 0.01% 37 1115 0.01% 38 1321 0.01% 39 1551 0.01% 40 1886 0.01% 41 2297 0.01% 42 2774 0.02% 43 3505 0.02% 44 4639 0.03% 45 6256 0.04% 46 8654 0.05% 47 12372 0.07% 48 19752 0.11% 49 29493 0.17% 50 17392999 99.40% 17497949 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.41 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=62.50 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.9 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGG Started job on | Dec 07 10:05:03 Started mapping on | Dec 07 10:05:03 Finished on | Dec 07 10:05:22 Mapping speed, Million of reads per hour | 3315.40 Number of input reads | 17497949 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16696365 Uniquely mapped reads % | 95.42% Average mapped length | 49.78 Number of splices: Total | 2637286 Number of splices: Annotated (sjdb) | 2543086 Number of splices: GT/AG | 2605811 Number of splices: GC/AG | 25947 Number of splices: AT/AC | 1632 Number of splices: Non-canonical | 3896 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462200 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 272481 % of reads mapped to too many loci | 1.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339384 339384 339384 N_multimapping 462200 462200 462200 N_noFeature 647350 16120552 729761 N_ambiguous 521009 1227 27876 UnstrandedReadsAssigned:15528006 PositiveStrandReadsAssigned:574586 NegativeStrandReadsAssigned:15938728 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322378 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322378-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,497,949 reads, 15,707,733 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR6322378.ke.tsv 35125 SRR6322378.se.tsv 88098 total ==> SRR6322378.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 52.0883 5.85506 PNS24249 1928 1829 3.82782 0.222312 PNS24246 1044 945 52.0883 5.85506 PNS24248 1044 945 52.0883 5.85506 PNS24244 1471 1372 65.9074 5.10275 PNS24243 293 194 0 0 KQK14069 1603 1504 380.502 26.8741 KQK14071 474 375 59.8304 16.9478 ==> SRR6322378.se.tsv <== BRADI_1g14170v3 503 BRADI_1g53295v3 155 BRADI_1g59795v3 326 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 5397 BRADI_1g74790v3 37 BRADI_1g09890v3 0 BRADI_1g77505v3 384 BRADI_1g48960v3 0 SRR6322378 completed mapping pipeline successfully