Starting /dee2/code/volunteer_pipeline.sh SRR6322379 current disk space = 1543820062720 free memory = 1598586408 SRR6322379 SRAfilesize 6def8506fdea94236bee1ccb601f2fd9 SRR6322379.sra SRR6322379.sra file validated SRR6322379 is single end SRR6322379 is conventional basespace SRR6322379 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.16375 33.0 33.0 34.0 27.0 34.0 2 32.36425 34.0 33.0 34.0 28.0 34.0 3 32.48425 34.0 33.0 34.0 30.0 34.0 4 32.4325 34.0 33.0 34.0 31.0 34.0 5 32.3675 34.0 33.0 34.0 31.0 34.0 6 36.25425 38.0 37.0 38.0 33.0 38.0 7 36.59475 38.0 37.0 38.0 34.0 38.0 8 36.6825 38.0 38.0 38.0 34.0 38.0 9 36.72925 38.0 38.0 38.0 34.0 38.0 10 36.731 38.0 38.0 38.0 35.0 38.0 11 36.712 38.0 38.0 38.0 34.0 38.0 12 36.851 38.0 38.0 38.0 35.0 38.0 13 36.6735 38.0 38.0 38.0 34.0 38.0 14 36.808 38.0 38.0 38.0 35.0 38.0 15 36.7485 38.0 38.0 38.0 35.0 38.0 16 36.807 38.0 38.0 38.0 35.0 38.0 17 36.84875 38.0 38.0 38.0 35.0 38.0 18 36.88575 38.0 38.0 38.0 35.0 38.0 19 36.8255 38.0 38.0 38.0 35.0 38.0 20 36.756 38.0 38.0 38.0 35.0 38.0 21 36.86225 38.0 38.0 38.0 35.0 38.0 22 36.8175 38.0 38.0 38.0 35.0 38.0 23 36.80425 38.0 38.0 38.0 35.0 38.0 24 36.816 38.0 38.0 38.0 35.0 38.0 25 36.78475 38.0 38.0 38.0 34.0 38.0 26 36.68875 38.0 38.0 38.0 34.0 38.0 27 36.676 38.0 38.0 38.0 34.0 38.0 28 36.676 38.0 38.0 38.0 34.0 38.0 29 36.7475 38.0 38.0 38.0 35.0 38.0 30 36.7005 38.0 38.0 38.0 35.0 38.0 31 36.73825 38.0 38.0 38.0 35.0 38.0 32 36.82 38.0 38.0 38.0 35.0 38.0 33 36.63175 38.0 38.0 38.0 34.0 38.0 34 36.75675 38.0 38.0 38.0 35.0 38.0 35 36.69675 38.0 38.0 38.0 34.0 38.0 36 36.6855 38.0 38.0 38.0 35.0 38.0 37 36.69575 38.0 38.0 38.0 35.0 38.0 38 36.72375 38.0 38.0 38.0 35.0 38.0 39 36.73225 38.0 38.0 38.0 34.0 38.0 40 36.6785 38.0 38.0 38.0 35.0 38.0 41 36.70425 38.0 38.0 38.0 35.0 38.0 42 36.69775 38.0 38.0 38.0 35.0 38.0 43 36.796 38.0 38.0 38.0 35.0 38.0 44 36.617 38.0 38.0 38.0 34.0 38.0 45 36.72675 38.0 38.0 38.0 35.0 38.0 46 36.54325 38.0 38.0 38.0 34.0 38.0 47 36.58075 38.0 38.0 38.0 35.0 38.0 48 36.60675 38.0 38.0 38.0 35.0 38.0 49 36.49575 38.0 38.0 38.0 34.0 38.0 50 36.267 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 5.0 24 5.0 25 11.0 26 16.0 27 30.0 28 28.0 29 49.0 30 61.0 31 69.0 32 101.0 33 116.0 34 162.0 35 253.0 36 581.0 37 2503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.989515072083876 10.773263433813893 8.17824377457405 45.05897771952817 2 22.675 14.85 35.675000000000004 26.8 3 21.0 18.65 23.150000000000002 37.2 4 25.45 25.15 21.75 27.650000000000002 5 26.1 30.525000000000002 23.200000000000003 20.175 6 21.325 33.324999999999996 24.05 21.3 7 16.675 23.425 40.375 19.525000000000002 8 19.85 23.549999999999997 29.725 26.875 9 19.875 22.775000000000002 33.225 24.125 10 20.175 35.699999999999996 25.275 18.85 11 26.325 25.75 22.400000000000002 25.525 12 22.475 22.75 28.075 26.700000000000003 13 21.55 25.95 27.525 24.975 14 20.3 26.924999999999997 28.249999999999996 24.525 15 21.65 25.224999999999998 27.275 25.85 16 22.825 25.650000000000002 26.375 25.15 17 22.1 27.224999999999998 26.8 23.875 18 22.2 26.174999999999997 25.424999999999997 26.200000000000003 19 21.475 27.400000000000002 25.724999999999998 25.4 20 22.05 26.6 26.924999999999997 24.425 21 22.0 24.85 26.6 26.55 22 21.575 27.075 25.124999999999996 26.224999999999998 23 23.150000000000002 25.8 26.174999999999997 24.875 24 21.725 25.775 27.05 25.45 25 23.575 26.075 25.25 25.1 26 23.075000000000003 26.400000000000002 25.4 25.124999999999996 27 22.400000000000002 25.4 26.724999999999998 25.474999999999998 28 21.925 27.275 26.224999999999998 24.575 29 23.0 25.1 26.875 25.025 30 22.575 26.1 26.400000000000002 24.925 31 21.5 26.325 27.200000000000003 24.975 32 23.200000000000003 25.900000000000002 25.6 25.3 33 22.400000000000002 26.1 26.85 24.65 34 21.8 26.3 26.525 25.374999999999996 35 23.150000000000002 26.5 25.174999999999997 25.174999999999997 36 23.05 26.8 24.575 25.575 37 21.875 26.775 26.25 25.1 38 22.025 26.55 26.6 24.825 39 21.25 26.575 25.775 26.400000000000002 40 22.175 27.1 25.5 25.224999999999998 41 22.95 26.700000000000003 25.025 25.324999999999996 42 21.75 25.55 26.375 26.325 43 20.95 27.05 26.450000000000003 25.55 44 22.925 26.424999999999997 26.375 24.275 45 22.0 24.4 26.775 26.825 46 22.15 26.200000000000003 25.724999999999998 25.924999999999997 47 22.1 25.025 28.025 24.85 48 21.5 25.374999999999996 25.75 27.375 49 21.925 26.525 25.575 25.974999999999998 50 20.825 26.174999999999997 27.675 25.324999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 1.5 22 3.0 23 6.0 24 9.0 25 14.5 26 20.0 27 26.0 28 32.0 29 41.5 30 51.0 31 62.5 32 74.0 33 90.5 34 107.0 35 145.0 36 183.0 37 195.5 38 208.0 39 244.5 40 281.0 41 299.0 42 317.0 43 329.5 44 342.0 45 358.0 46 374.0 47 359.5 48 345.0 49 329.0 50 313.0 51 281.0 52 249.0 53 231.5 54 214.0 55 194.5 56 175.0 57 153.5 58 132.0 59 135.0 60 138.0 61 122.5 62 107.0 63 90.0 64 73.0 65 70.5 66 68.0 67 60.0 68 52.0 69 47.5 70 43.0 71 34.5 72 26.0 73 27.5 74 29.0 75 21.0 76 13.0 77 10.0 78 7.0 79 7.0 80 7.0 81 4.5 82 2.0 83 2.0 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945131 spots for SRR6322379.sra Written 945131 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra Read 945123 spots for SRR6322379.sra Written 945123 spots for SRR6322379.sra SRR ids: ['SRR6322379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eo1vqvt_ SRR6322379.sra spots: 18902468 blocks: [[1, 945123], [945124, 1890246], [1890247, 2835369], [2835370, 3780492], [3780493, 4725615], [4725616, 5670738], [5670739, 6615861], [6615862, 7560984], [7560985, 8506107], [8506108, 9451230], [9451231, 10396353], [10396354, 11341476], [11341477, 12286599], [12286600, 13231722], [13231723, 14176845], [14176846, 15121968], [15121969, 16067091], [16067092, 17012214], [17012215, 17957337], [17957338, 18902468]] SRR6322379 file size 3283894 SRR6322379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322379 SRR6322379_1.fastq Input file: SRR6322379_1.fastq trimmed: SRR6322379-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:04:58 2024 >> started Sat Dec 7 10:05:09 2024 >> done (11.265s) 18902468 reads processed; of these: 3347 ( 0.02%) short reads filtered out after trimming by size control 24879 ( 0.13%) empty reads filtered out after trimming by size control 18874242 (99.85%) reads available; of these: 245864 ( 1.30%) trimmed reads available after processing 18628378 (98.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 230 0.00% 19 229 0.00% 20 287 0.00% 21 309 0.00% 22 401 0.00% 23 459 0.00% 24 671 0.00% 25 805 0.00% 26 767 0.00% 27 902 0.00% 28 836 0.00% 29 875 0.00% 30 1053 0.01% 31 1214 0.01% 32 1257 0.01% 33 1412 0.01% 34 1683 0.01% 35 1731 0.01% 36 2125 0.01% 37 2502 0.01% 38 3080 0.02% 39 3626 0.02% 40 4363 0.02% 41 5544 0.03% 42 6926 0.04% 43 9023 0.05% 44 11553 0.06% 45 15579 0.08% 46 21240 0.11% 47 29362 0.16% 48 45334 0.24% 49 70486 0.37% 50 18628378 98.70% 18874242 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.47 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=1.0 sequence=TCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAACGCGTTAGCTACAGCACTGCACGGGTCGAGTCGCACAGCACCTAGTATCCATCGTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTTCTTTCCGATCTCAATGCATTTCACCGCTCCACCGGAAATTCCCTCTGCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGATTTGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=19 fanout-score=15.30 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=1.9 sequence=CGGCCATCCTCCAGCTGCTT Started job on | Dec 07 10:05:20 Started mapping on | Dec 07 10:05:21 Finished on | Dec 07 10:05:41 Mapping speed, Million of reads per hour | 3397.36 Number of input reads | 18874242 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 17509587 Uniquely mapped reads % | 92.77% Average mapped length | 49.77 Number of splices: Total | 2615672 Number of splices: Annotated (sjdb) | 2526498 Number of splices: GT/AG | 2577764 Number of splices: GC/AG | 33453 Number of splices: AT/AC | 1452 Number of splices: Non-canonical | 3003 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 780034 % of reads mapped to multiple loci | 4.13% Number of reads mapped to too many loci | 425337 % of reads mapped to too many loci | 2.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 584621 584621 584621 N_multimapping 780034 780034 780034 N_noFeature 1063083 17060207 1199467 N_ambiguous 339621 1033 26924 UnstrandedReadsAssigned:16106883 PositiveStrandReadsAssigned:448347 NegativeStrandReadsAssigned:16283196 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322379 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322379-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,874,242 reads, 16,249,030 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6322379.ke.tsv 35125 SRR6322379.se.tsv 88098 total ==> SRR6322379.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 77.9767 9.99088 PNS24247 1044 945 46.9874 5.3323 PNS24249 1928 1829 29.4423 1.72632 PNS24246 1044 945 46.9874 5.3323 PNS24248 1044 945 46.9874 5.3323 PNS24244 1471 1372 171.619 13.4145 PNS24243 293 194 0 0 KQK14069 1603 1504 2294.06 163.577 KQK14071 474 375 389.844 111.487 ==> SRR6322379.se.tsv <== BRADI_1g14170v3 3091 BRADI_1g53295v3 81 BRADI_1g59795v3 760 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 138 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR6322379 completed mapping pipeline successfully