Starting /dee2/code/volunteer_pipeline.sh SRR6322380 current disk space = 1543809646592 free memory = 1487933120 SRR6322380 SRAfilesize fb77b1fb43aaba8122e3f23c5a7a919b SRR6322380.sra SRR6322380.sra file validated SRR6322380 is single end SRR6322380 is conventional basespace SRR6322380 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.78375 34.0 33.0 34.0 25.0 34.0 2 32.66075 34.0 33.0 34.0 28.0 34.0 3 32.8005 34.0 33.0 34.0 31.0 34.0 4 33.043 34.0 33.0 34.0 32.0 34.0 5 33.05525 34.0 33.0 34.0 32.0 34.0 6 36.88225 38.0 38.0 38.0 35.0 38.0 7 37.14675 38.0 38.0 38.0 36.0 38.0 8 37.25975 38.0 38.0 38.0 37.0 38.0 9 37.305 38.0 38.0 38.0 37.0 38.0 10 37.21925 38.0 38.0 38.0 37.0 38.0 11 37.29075 38.0 38.0 38.0 37.0 38.0 12 37.27325 38.0 38.0 38.0 37.0 38.0 13 37.3325 38.0 38.0 38.0 37.0 38.0 14 37.30475 38.0 38.0 38.0 37.0 38.0 15 37.288 38.0 38.0 38.0 37.0 38.0 16 37.315 38.0 38.0 38.0 37.0 38.0 17 37.336 38.0 38.0 38.0 37.0 38.0 18 37.31 38.0 38.0 38.0 37.0 38.0 19 37.2975 38.0 38.0 38.0 37.0 38.0 20 37.2395 38.0 38.0 38.0 37.0 38.0 21 37.261 38.0 38.0 38.0 37.0 38.0 22 37.27675 38.0 38.0 38.0 37.0 38.0 23 37.33475 38.0 38.0 38.0 37.0 38.0 24 37.339 38.0 38.0 38.0 37.0 38.0 25 37.2375 38.0 38.0 38.0 37.0 38.0 26 37.2495 38.0 38.0 38.0 37.0 38.0 27 37.23175 38.0 38.0 38.0 37.0 38.0 28 37.22675 38.0 38.0 38.0 37.0 38.0 29 37.213 38.0 38.0 38.0 37.0 38.0 30 37.264 38.0 38.0 38.0 37.0 38.0 31 37.24875 38.0 38.0 38.0 37.0 38.0 32 37.19075 38.0 38.0 38.0 37.0 38.0 33 37.15075 38.0 38.0 38.0 37.0 38.0 34 37.14725 38.0 38.0 38.0 37.0 38.0 35 37.2275 38.0 38.0 38.0 37.0 38.0 36 37.24025 38.0 38.0 38.0 37.0 38.0 37 37.137 38.0 38.0 38.0 37.0 38.0 38 37.24325 38.0 38.0 38.0 37.0 38.0 39 37.124 38.0 38.0 38.0 36.0 38.0 40 37.2075 38.0 38.0 38.0 37.0 38.0 41 37.21975 38.0 38.0 38.0 37.0 38.0 42 37.20175 38.0 38.0 38.0 37.0 38.0 43 37.204 38.0 38.0 38.0 37.0 38.0 44 37.20625 38.0 38.0 38.0 37.0 38.0 45 37.11925 38.0 38.0 38.0 37.0 38.0 46 37.16775 38.0 38.0 38.0 37.0 38.0 47 37.207 38.0 38.0 38.0 37.0 38.0 48 37.0915 38.0 38.0 38.0 37.0 38.0 49 37.0455 38.0 38.0 38.0 37.0 38.0 50 37.1035 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 0.0 23 3.0 24 3.0 25 6.0 26 8.0 27 17.0 28 21.0 29 21.0 30 35.0 31 44.0 32 52.0 33 78.0 34 88.0 35 146.0 36 547.0 37 2925.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.731786292498654 9.417161359956827 7.177549919050189 34.67350242849434 2 23.474999999999998 10.475 34.825 31.225 3 19.15 15.7 28.050000000000004 37.1 4 24.325 23.175 23.375 29.125 5 26.1 27.05 24.224999999999998 22.625 6 22.900000000000002 31.674999999999997 23.674999999999997 21.75 7 17.9 24.975 38.175 18.95 8 20.1 24.95 31.924999999999997 23.025000000000002 9 18.575 22.5 34.9 24.025 10 21.475 34.425 25.6 18.5 11 25.6 25.95 22.95 25.5 12 23.525 22.875 28.175 25.424999999999997 13 22.975 24.975 27.925 24.125 14 22.05 27.250000000000004 27.375 23.325000000000003 15 21.675 25.650000000000002 27.1 25.575 16 21.925 25.424999999999997 26.400000000000002 26.25 17 22.85 24.85 27.05 25.25 18 22.425 26.325 25.575 25.674999999999997 19 22.6 25.4 25.95 26.05 20 21.75 25.8 26.900000000000002 25.55 21 20.974999999999998 25.775 27.875 25.374999999999996 22 21.925 26.950000000000003 24.9 26.224999999999998 23 22.075 25.974999999999998 26.674999999999997 25.275 24 21.0 25.624999999999996 26.900000000000002 26.474999999999998 25 22.15 26.6 26.35 24.9 26 22.45 26.174999999999997 27.05 24.325 27 21.25 26.3 26.224999999999998 26.224999999999998 28 21.9 26.200000000000003 26.150000000000002 25.75 29 22.400000000000002 25.224999999999998 26.35 26.025 30 21.725 26.900000000000002 27.6 23.775 31 22.275 27.224999999999998 24.25 26.25 32 22.175 26.85 26.85 24.125 33 22.400000000000002 25.8 25.3 26.5 34 22.725 26.474999999999998 25.724999999999998 25.074999999999996 35 22.6 27.425 24.925 25.05 36 21.625 25.5 27.650000000000002 25.224999999999998 37 22.15 27.400000000000002 25.95 24.5 38 22.625 25.35 26.125 25.900000000000002 39 21.349999999999998 26.25 26.700000000000003 25.7 40 22.35 25.4 26.8 25.45 41 22.575 26.575 26.174999999999997 24.675 42 22.075 25.35 27.650000000000002 24.925 43 21.475 27.125 25.45 25.95 44 23.3 25.174999999999997 26.724999999999998 24.8 45 22.475 26.450000000000003 25.775 25.3 46 23.075000000000003 26.575 25.974999999999998 24.375 47 22.35 25.85 26.625 25.174999999999997 48 22.425 25.8 25.624999999999996 26.150000000000002 49 21.8 27.175 25.5 25.525 50 22.475 26.775 25.35 25.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 3.5 22 6.0 23 6.0 24 6.0 25 9.0 26 12.0 27 20.0 28 28.0 29 29.5 30 31.0 31 42.0 32 53.0 33 80.0 34 107.0 35 137.0 36 167.0 37 190.5 38 214.0 39 248.0 40 282.0 41 284.0 42 286.0 43 331.5 44 377.0 45 386.5 46 396.0 47 356.5 48 317.0 49 316.0 50 315.0 51 299.0 52 283.0 53 262.0 54 241.0 55 224.5 56 208.0 57 185.5 58 163.0 59 152.5 60 142.0 61 123.5 62 105.0 63 92.0 64 79.0 65 65.0 66 51.0 67 50.5 68 50.0 69 39.0 70 28.0 71 24.5 72 21.0 73 17.0 74 13.0 75 9.5 76 6.0 77 6.5 78 7.0 79 4.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973764 spots for SRR6322380.sra Written 973764 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra Read 973762 spots for SRR6322380.sra Written 973762 spots for SRR6322380.sra SRR ids: ['SRR6322380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9_1aj9a7 SRR6322380.sra spots: 19475242 blocks: [[1, 973762], [973763, 1947524], [1947525, 2921286], [2921287, 3895048], [3895049, 4868810], [4868811, 5842572], [5842573, 6816334], [6816335, 7790096], [7790097, 8763858], [8763859, 9737620], [9737621, 10711382], [10711383, 11685144], [11685145, 12658906], [12658907, 13632668], [13632669, 14606430], [14606431, 15580192], [15580193, 16553954], [16553955, 17527716], [17527717, 18501478], [18501479, 19475242]] SRR6322380 file size 3383813 SRR6322380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322380 SRR6322380_1.fastq Input file: SRR6322380_1.fastq trimmed: SRR6322380-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:08:23 2024 >> started Sat Dec 7 10:09:12 2024 >> done (49.273s) 19475242 reads processed; of these: 3766 ( 0.02%) short reads filtered out after trimming by size control 9121 ( 0.05%) empty reads filtered out after trimming by size control 19462355 (99.93%) reads available; of these: 118600 ( 0.61%) trimmed reads available after processing 19343755 (99.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 228 0.00% 19 303 0.00% 20 332 0.00% 21 337 0.00% 22 441 0.00% 23 555 0.00% 24 1059 0.01% 25 800 0.00% 26 728 0.00% 27 602 0.00% 28 648 0.00% 29 650 0.00% 30 688 0.00% 31 738 0.00% 32 772 0.00% 33 795 0.00% 34 963 0.00% 35 1024 0.01% 36 1221 0.01% 37 1308 0.01% 38 1549 0.01% 39 1794 0.01% 40 2187 0.01% 41 2625 0.01% 42 3260 0.02% 43 4133 0.02% 44 5514 0.03% 45 7162 0.04% 46 9644 0.05% 47 13816 0.07% 48 21313 0.11% 49 31411 0.16% 50 19343755 99.39% 19462355 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=26 prefix-density=0.17 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=24.70 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.7 sequence=CTCCTCCTCCTTCTTCTT Started job on | Dec 07 10:10:46 Started mapping on | Dec 07 10:10:47 Finished on | Dec 07 10:13:17 Mapping speed, Million of reads per hour | 467.10 Number of input reads | 19462355 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18594423 Uniquely mapped reads % | 95.54% Average mapped length | 49.79 Number of splices: Total | 2785921 Number of splices: Annotated (sjdb) | 2676428 Number of splices: GT/AG | 2750165 Number of splices: GC/AG | 28911 Number of splices: AT/AC | 1960 Number of splices: Non-canonical | 4885 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512817 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 265871 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 355115 355115 355115 N_multimapping 512817 512817 512817 N_noFeature 1113140 17939781 1233275 N_ambiguous 570812 1484 37228 UnstrandedReadsAssigned:16910471 PositiveStrandReadsAssigned:653158 NegativeStrandReadsAssigned:17323920 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322380 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322380-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,462,355 reads, 17,038,753 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,248 rounds 52973 SRR6322380.ke.tsv 35125 SRR6322380.se.tsv 88098 total ==> SRR6322380.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 68.9432 8.69399 PNS24247 1044 945 51.4246 5.74372 PNS24249 1928 1829 4.00219 0.23096 PNS24246 1044 945 51.4246 5.74372 PNS24248 1044 945 51.4246 5.74372 PNS24244 1471 1372 110.781 8.52243 PNS24243 293 194 0 0 KQK14069 1603 1504 448.894 31.5029 KQK14071 474 375 10.3205 2.90486 ==> SRR6322380.se.tsv <== BRADI_1g14170v3 506 BRADI_1g53295v3 318 BRADI_1g59795v3 424 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 4358 BRADI_1g74790v3 54 BRADI_1g09890v3 0 BRADI_1g77505v3 563 BRADI_1g48960v3 0 SRR6322380 completed mapping pipeline successfully