Starting /dee2/code/volunteer_pipeline.sh SRR6322381 current disk space = 1543108472832 free memory = 1606451440 SRR6322381 SRAfilesize 5809ed70e10a5c3a31a09bcab7e9270c SRR6322381.sra SRR6322381.sra file validated SRR6322381 is single end SRR6322381 is conventional basespace SRR6322381 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.953 34.0 33.0 34.0 32.0 34.0 2 32.8125 34.0 33.0 34.0 31.0 34.0 3 32.9665 34.0 33.0 34.0 32.0 34.0 4 33.01825 34.0 33.0 34.0 32.0 34.0 5 32.94425 34.0 33.0 34.0 32.0 34.0 6 36.81725 38.0 38.0 38.0 35.0 38.0 7 37.08275 38.0 38.0 38.0 36.0 38.0 8 37.216 38.0 38.0 38.0 36.0 38.0 9 37.28375 38.0 38.0 38.0 37.0 38.0 10 37.2475 38.0 38.0 38.0 37.0 38.0 11 37.23775 38.0 38.0 38.0 37.0 38.0 12 37.17375 38.0 38.0 38.0 37.0 38.0 13 37.29125 38.0 38.0 38.0 37.0 38.0 14 37.179 38.0 38.0 38.0 37.0 38.0 15 37.23625 38.0 38.0 38.0 37.0 38.0 16 37.227 38.0 38.0 38.0 37.0 38.0 17 37.24025 38.0 38.0 38.0 37.0 38.0 18 37.17125 38.0 38.0 38.0 37.0 38.0 19 37.265 38.0 38.0 38.0 37.0 38.0 20 37.227 38.0 38.0 38.0 37.0 38.0 21 37.20975 38.0 38.0 38.0 37.0 38.0 22 37.253 38.0 38.0 38.0 37.0 38.0 23 37.2035 38.0 38.0 38.0 37.0 38.0 24 37.2385 38.0 38.0 38.0 37.0 38.0 25 37.26 38.0 38.0 38.0 37.0 38.0 26 37.264 38.0 38.0 38.0 37.0 38.0 27 37.236 38.0 38.0 38.0 37.0 38.0 28 37.16575 38.0 38.0 38.0 37.0 38.0 29 37.14325 38.0 38.0 38.0 36.0 38.0 30 37.221 38.0 38.0 38.0 37.0 38.0 31 37.1475 38.0 38.0 38.0 37.0 38.0 32 37.21875 38.0 38.0 38.0 37.0 38.0 33 37.03525 38.0 38.0 38.0 36.0 38.0 34 37.10375 38.0 38.0 38.0 36.0 38.0 35 37.083 38.0 38.0 38.0 36.0 38.0 36 37.09725 38.0 38.0 38.0 36.0 38.0 37 37.0885 38.0 38.0 38.0 36.0 38.0 38 37.144 38.0 38.0 38.0 36.0 38.0 39 37.14825 38.0 38.0 38.0 37.0 38.0 40 37.16 38.0 38.0 38.0 37.0 38.0 41 37.14825 38.0 38.0 38.0 36.0 38.0 42 37.13975 38.0 38.0 38.0 37.0 38.0 43 37.17525 38.0 38.0 38.0 37.0 38.0 44 37.2205 38.0 38.0 38.0 37.0 38.0 45 37.18875 38.0 38.0 38.0 37.0 38.0 46 37.14375 38.0 38.0 38.0 37.0 38.0 47 37.14125 38.0 38.0 38.0 37.0 38.0 48 37.1055 38.0 38.0 38.0 36.0 38.0 49 37.0315 38.0 38.0 38.0 36.0 38.0 50 37.06025 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 1.0 24 4.0 25 7.0 26 12.0 27 13.0 28 24.0 29 26.0 30 32.0 31 27.0 32 57.0 33 92.0 34 99.0 35 164.0 36 473.0 37 2961.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.874870734229575 10.47052740434333 8.169596690796277 43.48500517063082 2 22.325 10.05 33.6 34.025 3 19.875 12.025 25.05 43.05 4 23.875 17.575 24.15 34.4 5 26.525 23.150000000000002 25.0 25.324999999999996 6 24.175 28.4 23.625 23.799999999999997 7 18.875 25.1 36.35 19.675 8 20.075000000000003 24.95 30.25 24.725 9 20.0 22.725 34.449999999999996 22.825 10 21.025 32.300000000000004 27.075 19.6 11 25.474999999999998 26.275 22.825 25.424999999999997 12 22.425 24.15 27.725 25.7 13 21.45 25.624999999999996 27.775 25.15 14 23.400000000000002 25.15 27.075 24.375 15 21.775 24.474999999999998 28.000000000000004 25.75 16 22.825 25.124999999999996 25.424999999999997 26.625 17 23.375 25.6 26.924999999999997 24.099999999999998 18 22.7 25.825 25.775 25.7 19 23.375 24.775 26.424999999999997 25.424999999999997 20 24.15 26.35 25.224999999999998 24.275 21 22.3 25.674999999999997 26.05 25.974999999999998 22 23.225 24.8 25.85 26.125 23 21.75 26.174999999999997 26.125 25.95 24 22.7 24.25 27.3 25.75 25 22.55 25.074999999999996 26.3 26.075 26 21.8 25.575 26.3 26.325 27 21.349999999999998 25.6 27.05 26.0 28 22.425 26.775 25.074999999999996 25.724999999999998 29 22.6 26.025 25.025 26.35 30 24.125 25.074999999999996 25.3 25.5 31 22.825 25.2 26.400000000000002 25.575 32 21.825 24.275 27.625 26.275 33 22.6 24.575 24.95 27.875 34 23.400000000000002 25.924999999999997 24.099999999999998 26.575 35 21.65 26.200000000000003 26.974999999999998 25.174999999999997 36 22.8 25.900000000000002 24.349999999999998 26.950000000000003 37 22.95 25.35 25.324999999999996 26.375 38 23.45 24.375 25.7 26.474999999999998 39 22.1 25.8 26.1 26.0 40 21.9 26.05 25.85 26.200000000000003 41 23.974999999999998 26.025 25.95 24.05 42 22.275 25.674999999999997 27.3 24.75 43 23.5 25.4 25.025 26.075 44 22.6 24.075 27.125 26.200000000000003 45 22.0 25.45 26.825 25.724999999999998 46 24.224999999999998 25.3 25.05 25.424999999999997 47 23.05 26.75 25.174999999999997 25.025 48 22.775000000000002 26.674999999999997 25.1 25.45 49 23.375 25.650000000000002 24.675 26.3 50 21.55 26.375 26.650000000000002 25.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 3.0 24 3.0 25 5.5 26 8.0 27 12.0 28 16.0 29 18.0 30 20.0 31 26.5 32 33.0 33 52.0 34 71.0 35 92.5 36 114.0 37 163.5 38 213.0 39 229.5 40 246.0 41 273.5 42 301.0 43 319.0 44 337.0 45 348.0 46 359.0 47 356.0 48 353.0 49 356.5 50 360.0 51 333.5 52 307.0 53 282.0 54 257.0 55 246.5 56 236.0 57 211.0 58 186.0 59 160.5 60 135.0 61 117.0 62 99.0 63 102.0 64 105.0 65 86.5 66 68.0 67 67.5 68 67.0 69 57.0 70 47.0 71 38.0 72 29.0 73 20.5 74 12.0 75 11.5 76 11.0 77 7.5 78 4.0 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673230 spots for SRR6322381.sra Written 673230 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra Read 673214 spots for SRR6322381.sra Written 673214 spots for SRR6322381.sra SRR ids: ['SRR6322381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2rf3bjuy SRR6322381.sra spots: 13464296 blocks: [[1, 673214], [673215, 1346428], [1346429, 2019642], [2019643, 2692856], [2692857, 3366070], [3366071, 4039284], [4039285, 4712498], [4712499, 5385712], [5385713, 6058926], [6058927, 6732140], [6732141, 7405354], [7405355, 8078568], [8078569, 8751782], [8751783, 9424996], [9424997, 10098210], [10098211, 10771424], [10771425, 11444638], [11444639, 12117852], [12117853, 12791066], [12791067, 13464296]] SRR6322381 file size 2336049 SRR6322381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322381 SRR6322381_1.fastq Input file: SRR6322381_1.fastq trimmed: SRR6322381-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:52:14 2024 >> started Sat Dec 7 11:52:22 2024 >> done (7.213s) 13464296 reads processed; of these: 2062 ( 0.02%) short reads filtered out after trimming by size control 4834 ( 0.04%) empty reads filtered out after trimming by size control 13457400 (99.95%) reads available; of these: 83449 ( 0.62%) trimmed reads available after processing 13373951 (99.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 124 0.00% 19 120 0.00% 20 123 0.00% 21 154 0.00% 22 181 0.00% 23 482 0.00% 24 343 0.00% 25 344 0.00% 26 401 0.00% 27 369 0.00% 28 315 0.00% 29 322 0.00% 30 370 0.00% 31 380 0.00% 32 446 0.00% 33 490 0.00% 34 566 0.00% 35 603 0.00% 36 709 0.01% 37 890 0.01% 38 1070 0.01% 39 1176 0.01% 40 1470 0.01% 41 1813 0.01% 42 2375 0.02% 43 2843 0.02% 44 3757 0.03% 45 5088 0.04% 46 6930 0.05% 47 9997 0.07% 48 15992 0.12% 49 23206 0.17% 50 13373951 99.38% 13457400 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=1.9 sequence=GTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=19.66 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.4 sequence=GATAGGGCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCGAGTTATCATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGTATTAGCTCTAGAATTACTACGGTTATCCGAGTAGCACGTACCATCAAACAAACTATAACTGATTTAATGAGCC Started job on | Dec 07 11:52:32 Started mapping on | Dec 07 11:52:32 Finished on | Dec 07 11:52:46 Mapping speed, Million of reads per hour | 3460.47 Number of input reads | 13457400 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 12667547 Uniquely mapped reads % | 94.13% Average mapped length | 49.78 Number of splices: Total | 2014866 Number of splices: Annotated (sjdb) | 1941942 Number of splices: GT/AG | 1990381 Number of splices: GC/AG | 20393 Number of splices: AT/AC | 1281 Number of splices: Non-canonical | 2811 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380610 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 350997 % of reads mapped to too many loci | 2.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 409243 409243 409243 N_multimapping 380610 380610 380610 N_noFeature 674600 12299008 744178 N_ambiguous 323788 920 25176 UnstrandedReadsAssigned:11669159 PositiveStrandReadsAssigned:367619 NegativeStrandReadsAssigned:11898193 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322381 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322381-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,457,400 reads, 11,736,970 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR6322381.ke.tsv 35125 SRR6322381.se.tsv 88098 total ==> SRR6322381.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 41.0467 7.163 PNS24247 1044 945 33.1489 5.12365 PNS24249 1928 1829 6.90818 0.551686 PNS24246 1044 945 33.1489 5.12365 PNS24248 1044 945 33.1489 5.12365 PNS24244 1471 1372 94.5984 10.071 PNS24243 293 194 0 0 KQK14069 1603 1504 280.532 27.2444 KQK14071 474 375 42.1593 16.4212 ==> SRR6322381.se.tsv <== BRADI_1g14170v3 354 BRADI_1g53295v3 175 BRADI_1g59795v3 354 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 2461 BRADI_1g74790v3 13 BRADI_1g09890v3 0 BRADI_1g77505v3 408 BRADI_1g48960v3 0 SRR6322381 completed mapping pipeline successfully