Starting /dee2/code/volunteer_pipeline.sh SRR6322382 current disk space = 1543113195520 free memory = 1603134080 SRR6322382 SRAfilesize 2aa33291750383c9fad605de0c5cb296 SRR6322382.sra SRR6322382.sra file validated SRR6322382 is single end SRR6322382 is conventional basespace SRR6322382 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.68775 34.0 33.0 34.0 32.0 34.0 2 32.85025 34.0 33.0 34.0 31.0 34.0 3 32.90475 34.0 33.0 34.0 32.0 34.0 4 33.0395 34.0 33.0 34.0 32.0 34.0 5 33.0085 34.0 33.0 34.0 32.0 34.0 6 36.85825 38.0 38.0 38.0 35.0 38.0 7 37.1185 38.0 38.0 38.0 36.0 38.0 8 37.252 38.0 38.0 38.0 37.0 38.0 9 37.33675 38.0 38.0 38.0 37.0 38.0 10 37.3705 38.0 38.0 38.0 37.0 38.0 11 37.36 38.0 38.0 38.0 37.0 38.0 12 37.28875 38.0 38.0 38.0 37.0 38.0 13 37.27325 38.0 38.0 38.0 37.0 38.0 14 37.25175 38.0 38.0 38.0 37.0 38.0 15 37.36775 38.0 38.0 38.0 37.0 38.0 16 37.3255 38.0 38.0 38.0 37.0 38.0 17 37.3195 38.0 38.0 38.0 37.0 38.0 18 37.33225 38.0 38.0 38.0 37.0 38.0 19 37.33925 38.0 38.0 38.0 37.0 38.0 20 37.2885 38.0 38.0 38.0 37.0 38.0 21 37.291 38.0 38.0 38.0 37.0 38.0 22 37.26275 38.0 38.0 38.0 37.0 38.0 23 37.23975 38.0 38.0 38.0 37.0 38.0 24 37.2735 38.0 38.0 38.0 37.0 38.0 25 37.26475 38.0 38.0 38.0 37.0 38.0 26 37.21925 38.0 38.0 38.0 37.0 38.0 27 37.175 38.0 38.0 38.0 37.0 38.0 28 37.246 38.0 38.0 38.0 37.0 38.0 29 37.1845 38.0 38.0 38.0 37.0 38.0 30 37.202 38.0 38.0 38.0 37.0 38.0 31 37.2125 38.0 38.0 38.0 37.0 38.0 32 37.26875 38.0 38.0 38.0 37.0 38.0 33 37.1505 38.0 38.0 38.0 37.0 38.0 34 37.07825 38.0 38.0 38.0 36.0 38.0 35 37.1515 38.0 38.0 38.0 37.0 38.0 36 37.1035 38.0 38.0 38.0 37.0 38.0 37 37.1945 38.0 38.0 38.0 37.0 38.0 38 37.2275 38.0 38.0 38.0 37.0 38.0 39 37.16825 38.0 38.0 38.0 37.0 38.0 40 37.153 38.0 38.0 38.0 37.0 38.0 41 37.1375 38.0 38.0 38.0 37.0 38.0 42 37.14275 38.0 38.0 38.0 36.0 38.0 43 37.1785 38.0 38.0 38.0 37.0 38.0 44 37.17775 38.0 38.0 38.0 37.0 38.0 45 37.30125 38.0 38.0 38.0 37.0 38.0 46 37.187 38.0 38.0 38.0 37.0 38.0 47 37.15075 38.0 38.0 38.0 37.0 38.0 48 37.14875 38.0 38.0 38.0 37.0 38.0 49 37.087 38.0 38.0 38.0 37.0 38.0 50 37.07575 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 3.0 23 3.0 24 2.0 25 14.0 26 9.0 27 15.0 28 18.0 29 33.0 30 30.0 31 34.0 32 42.0 33 66.0 34 93.0 35 165.0 36 440.0 37 3028.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.538421327757455 10.925248301097753 7.9194981704129646 40.616832200731835 2 22.6 12.125 34.35 30.925000000000004 3 20.5 14.124999999999998 25.775 39.6 4 23.75 20.525 22.975 32.75 5 26.924999999999997 25.874999999999996 23.849999999999998 23.35 6 24.2 29.599999999999998 23.375 22.825 7 19.35 25.525 36.7 18.425 8 20.150000000000002 25.6 29.9 24.349999999999998 9 19.900000000000002 22.75 33.45 23.9 10 20.7 33.575 26.125 19.6 11 24.025 26.900000000000002 23.025000000000002 26.05 12 22.85 23.799999999999997 26.224999999999998 27.125 13 21.575 25.0 28.000000000000004 25.424999999999997 14 21.525 26.625 26.575 25.275 15 21.975 24.975 26.55 26.5 16 21.975 25.25 27.525 25.25 17 22.875 25.45 26.275 25.4 18 22.775000000000002 25.474999999999998 26.174999999999997 25.575 19 22.15 25.174999999999997 26.1 26.575 20 22.2 27.0 25.674999999999997 25.124999999999996 21 22.7 25.775 26.775 24.75 22 22.525000000000002 26.174999999999997 25.1 26.200000000000003 23 20.925 25.45 27.3 26.325 24 23.025000000000002 24.95 27.35 24.675 25 22.95 26.200000000000003 25.124999999999996 25.724999999999998 26 21.8 24.325 26.825 27.05 27 22.475 24.875 26.900000000000002 25.75 28 22.900000000000002 26.875 25.0 25.224999999999998 29 22.875 25.45 25.924999999999997 25.75 30 23.9 24.375 25.924999999999997 25.8 31 22.925 26.1 25.75 25.224999999999998 32 22.525000000000002 24.125 27.325 26.025 33 21.95 26.575 25.624999999999996 25.85 34 24.125 25.95 25.074999999999996 24.85 35 22.975 27.0 25.275 24.75 36 22.775000000000002 25.974999999999998 25.7 25.55 37 22.95 26.0 25.650000000000002 25.4 38 23.150000000000002 25.95 26.325 24.575 39 23.025000000000002 26.424999999999997 24.8 25.75 40 22.45 27.075 24.525 25.95 41 22.775000000000002 27.35 24.825 25.05 42 23.225 26.025 25.4 25.35 43 23.275000000000002 25.825 26.424999999999997 24.474999999999998 44 20.825 26.325 27.425 25.424999999999997 45 22.375 24.775 25.874999999999996 26.974999999999998 46 23.225 26.35 24.725 25.7 47 22.1 26.474999999999998 25.95 25.474999999999998 48 21.425 24.45 28.075 26.05 49 22.1 25.224999999999998 26.35 26.325 50 22.475 24.825 26.55 26.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 4.0 24 7.0 25 7.5 26 8.0 27 13.5 28 19.0 29 26.0 30 33.0 31 39.0 32 45.0 33 64.5 34 84.0 35 107.0 36 130.0 37 159.0 38 188.0 39 226.5 40 265.0 41 288.0 42 311.0 43 342.5 44 374.0 45 354.5 46 335.0 47 329.5 48 324.0 49 340.0 50 356.0 51 325.5 52 295.0 53 278.5 54 262.0 55 250.0 56 238.0 57 215.0 58 192.0 59 164.0 60 136.0 61 121.5 62 107.0 63 94.5 64 82.0 65 80.0 66 78.0 67 60.0 68 42.0 69 38.0 70 34.0 71 28.5 72 23.0 73 19.0 74 15.0 75 11.5 76 8.0 77 7.0 78 6.0 79 3.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra Read 963699 spots for SRR6322382.sra Written 963699 spots for SRR6322382.sra Read 963697 spots for SRR6322382.sra Written 963697 spots for SRR6322382.sra SRR ids: ['SRR6322382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v5547s2s SRR6322382.sra spots: 19273942 blocks: [[1, 963697], [963698, 1927394], [1927395, 2891091], [2891092, 3854788], [3854789, 4818485], [4818486, 5782182], [5782183, 6745879], [6745880, 7709576], [7709577, 8673273], [8673274, 9636970], [9636971, 10600667], [10600668, 11564364], [11564365, 12528061], [12528062, 13491758], [13491759, 14455455], [14455456, 15419152], [15419153, 16382849], [16382850, 17346546], [17346547, 18310243], [18310244, 19273942]] SRR6322382 file size 3348700 SRR6322382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322382 SRR6322382_1.fastq Input file: SRR6322382_1.fastq trimmed: SRR6322382-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:52:49 2024 >> started Sat Dec 7 11:53:01 2024 >> done (11.582s) 19273942 reads processed; of these: 2959 ( 0.02%) short reads filtered out after trimming by size control 6313 ( 0.03%) empty reads filtered out after trimming by size control 19264670 (99.95%) reads available; of these: 114619 ( 0.59%) trimmed reads available after processing 19150051 (99.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 169 0.00% 19 178 0.00% 20 211 0.00% 21 184 0.00% 22 245 0.00% 23 698 0.00% 24 429 0.00% 25 495 0.00% 26 598 0.00% 27 420 0.00% 28 445 0.00% 29 474 0.00% 30 525 0.00% 31 591 0.00% 32 617 0.00% 33 672 0.00% 34 813 0.00% 35 852 0.00% 36 1027 0.01% 37 1168 0.01% 38 1386 0.01% 39 1707 0.01% 40 2023 0.01% 41 2437 0.01% 42 3220 0.02% 43 4152 0.02% 44 5205 0.03% 45 7074 0.04% 46 9567 0.05% 47 13855 0.07% 48 21693 0.11% 49 31489 0.16% 50 19150051 99.41% 19264670 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=18 prefix-density=0.20 prefix-fanout=3.5 sequence=CATCGGTGTTCACTTCTGGACCGTACCTAAAAATTCTGTTCTTCTGGTCATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=8 fanout-score=31.69 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=11.5 sequence=CTCCTCCTCCTTCTTCTTG Started job on | Dec 07 11:53:12 Started mapping on | Dec 07 11:53:12 Finished on | Dec 07 11:53:31 Mapping speed, Million of reads per hour | 3650.15 Number of input reads | 19264670 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18416939 Uniquely mapped reads % | 95.60% Average mapped length | 49.77 Number of splices: Total | 2937977 Number of splices: Annotated (sjdb) | 2833302 Number of splices: GT/AG | 2902472 Number of splices: GC/AG | 29426 Number of splices: AT/AC | 1915 Number of splices: Non-canonical | 4164 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527750 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 243386 % of reads mapped to too many loci | 1.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 319981 319981 319981 N_multimapping 527750 527750 527750 N_noFeature 849277 17749918 971323 N_ambiguous 584784 1576 40217 UnstrandedReadsAssigned:16982878 PositiveStrandReadsAssigned:665445 NegativeStrandReadsAssigned:17405399 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322382 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322382-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,264,670 reads, 17,190,893 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,332 rounds 52973 SRR6322382.ke.tsv 35125 SRR6322382.se.tsv 88098 total ==> SRR6322382.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 91.622 11.4456 PNS24247 1044 945 26.25 2.90443 PNS24249 1928 1829 4.00219 0.228795 PNS24246 1044 945 26.25 2.90443 PNS24248 1044 945 26.25 2.90443 PNS24244 1471 1372 81.6258 6.22066 PNS24243 293 194 0 0 KQK14069 1603 1504 280.733 19.5168 KQK14071 474 375 12.7423 3.55287 ==> SRR6322382.se.tsv <== BRADI_1g14170v3 303 BRADI_1g53295v3 216 BRADI_1g59795v3 347 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 5582 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 462 BRADI_1g48960v3 0 SRR6322382 completed mapping pipeline successfully