Starting /dee2/code/volunteer_pipeline.sh SRR6322383 current disk space = 1543104978944 free memory = 1602591624 SRR6322383 SRAfilesize ed439df709932319b742a307aee4d9ba SRR6322383.sra SRR6322383.sra file validated SRR6322383 is single end SRR6322383 is conventional basespace SRR6322383 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.765 33.0 33.0 34.0 25.0 34.0 2 32.3 33.0 33.0 34.0 28.0 34.0 3 32.32 34.0 33.0 34.0 28.0 34.0 4 32.4535 33.0 33.0 34.0 31.0 34.0 5 32.50425 33.0 33.0 34.0 31.0 34.0 6 36.4115 38.0 37.0 38.0 34.0 38.0 7 36.7595 38.0 38.0 38.0 34.0 38.0 8 36.91325 38.0 38.0 38.0 35.0 38.0 9 36.754 38.0 38.0 38.0 34.0 38.0 10 36.8845 38.0 38.0 38.0 35.0 38.0 11 37.03175 38.0 38.0 38.0 36.0 38.0 12 36.9715 38.0 38.0 38.0 36.0 38.0 13 37.00425 38.0 38.0 38.0 36.0 38.0 14 37.04825 38.0 38.0 38.0 36.0 38.0 15 37.0255 38.0 38.0 38.0 36.0 38.0 16 37.03225 38.0 38.0 38.0 35.0 38.0 17 36.97975 38.0 38.0 38.0 35.0 38.0 18 36.89925 38.0 38.0 38.0 35.0 38.0 19 37.0395 38.0 38.0 38.0 36.0 38.0 20 37.07475 38.0 38.0 38.0 36.0 38.0 21 37.031 38.0 38.0 38.0 36.0 38.0 22 36.9785 38.0 38.0 38.0 36.0 38.0 23 36.966 38.0 38.0 38.0 36.0 38.0 24 36.9 38.0 38.0 38.0 35.0 38.0 25 36.928 38.0 38.0 38.0 36.0 38.0 26 36.91525 38.0 38.0 38.0 35.0 38.0 27 36.96825 38.0 38.0 38.0 36.0 38.0 28 36.86375 38.0 38.0 38.0 35.0 38.0 29 36.85 38.0 38.0 38.0 35.0 38.0 30 36.8215 38.0 38.0 38.0 35.0 38.0 31 36.8685 38.0 38.0 38.0 35.0 38.0 32 36.92225 38.0 38.0 38.0 36.0 38.0 33 36.87025 38.0 38.0 38.0 35.0 38.0 34 36.82975 38.0 38.0 38.0 35.0 38.0 35 36.80825 38.0 38.0 38.0 35.0 38.0 36 36.90825 38.0 38.0 38.0 36.0 38.0 37 36.9145 38.0 38.0 38.0 35.0 38.0 38 36.903 38.0 38.0 38.0 35.0 38.0 39 36.8365 38.0 38.0 38.0 35.0 38.0 40 36.87425 38.0 38.0 38.0 35.0 38.0 41 36.86 38.0 38.0 38.0 35.0 38.0 42 36.7955 38.0 38.0 38.0 35.0 38.0 43 36.90725 38.0 38.0 38.0 35.0 38.0 44 36.8065 38.0 38.0 38.0 35.0 38.0 45 36.81275 38.0 38.0 38.0 35.0 38.0 46 36.766 38.0 38.0 38.0 35.0 38.0 47 36.82025 38.0 38.0 38.0 35.0 38.0 48 36.735 38.0 38.0 38.0 35.0 38.0 49 36.7095 38.0 38.0 38.0 35.0 38.0 50 36.42425 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 9.0 25 17.0 26 20.0 27 21.0 28 24.0 29 25.0 30 43.0 31 65.0 32 91.0 33 108.0 34 145.0 35 236.0 36 638.0 37 2550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75967957276369 10.54739652870494 7.903871829105475 41.7890520694259 2 23.35 14.249999999999998 34.8 27.6 3 21.425 18.425 24.525 35.625 4 26.650000000000002 26.325 20.150000000000002 26.875 5 25.874999999999996 31.924999999999997 22.125 20.075000000000003 6 21.75 33.925 22.25 22.075 7 17.95 22.25 39.75 20.05 8 21.075 22.825 27.900000000000002 28.199999999999996 9 19.5 21.65 32.675 26.174999999999997 10 21.8 34.825 23.65 19.725 11 26.125 25.3 20.849999999999998 27.725 12 24.05 21.75 26.075 28.125 13 23.1 25.0 26.875 25.025 14 21.8 25.6 26.375 26.224999999999998 15 23.150000000000002 25.525 26.25 25.074999999999996 16 22.925 26.625 25.0 25.45 17 21.6 26.1 27.1 25.2 18 23.849999999999998 24.45 25.825 25.874999999999996 19 22.8 25.825 25.324999999999996 26.05 20 21.425 27.6 25.7 25.275 21 23.974999999999998 26.125 24.925 24.975 22 24.2 25.525 24.7 25.575 23 22.525000000000002 25.85 25.650000000000002 25.974999999999998 24 23.175 25.424999999999997 25.1 26.3 25 23.474999999999998 25.074999999999996 25.474999999999998 25.974999999999998 26 23.425 25.224999999999998 24.7 26.650000000000002 27 23.125 25.924999999999997 24.425 26.525 28 23.200000000000003 25.624999999999996 25.4 25.775 29 24.15 25.1 25.55 25.2 30 21.525 25.924999999999997 25.55 27.0 31 23.325000000000003 24.375 25.85 26.450000000000003 32 23.400000000000002 25.825 25.15 25.624999999999996 33 23.275000000000002 25.2 25.825 25.7 34 24.725 24.325 24.325 26.625 35 23.025000000000002 25.3 25.8 25.874999999999996 36 22.05 26.8 24.625 26.525 37 24.7 24.75 25.25 25.3 38 23.575 25.074999999999996 24.7 26.650000000000002 39 23.375 24.3 25.1 27.224999999999998 40 23.25 24.55 25.8 26.400000000000002 41 23.65 25.624999999999996 24.4 26.325 42 22.2 26.5 25.174999999999997 26.125 43 22.0 25.45 25.624999999999996 26.924999999999997 44 23.425 25.674999999999997 26.35 24.55 45 23.849999999999998 23.75 25.55 26.85 46 22.875 24.925 25.324999999999996 26.875 47 23.200000000000003 25.650000000000002 25.3 25.85 48 23.125 25.2 25.8 25.874999999999996 49 23.925 24.275 26.0 25.8 50 23.525 24.825 25.924999999999997 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 3.5 24 4.0 25 4.0 26 4.0 27 11.0 28 18.0 29 33.0 30 48.0 31 52.5 32 57.0 33 66.5 34 76.0 35 108.0 36 140.0 37 174.5 38 209.0 39 228.5 40 248.0 41 276.0 42 304.0 43 311.0 44 318.0 45 331.0 46 344.0 47 320.0 48 296.0 49 306.5 50 317.0 51 285.5 52 254.0 53 240.5 54 227.0 55 232.0 56 237.0 57 210.0 58 183.0 59 172.5 60 162.0 61 150.0 62 138.0 63 118.5 64 99.0 65 91.5 66 84.0 67 79.5 68 75.0 69 61.0 70 47.0 71 46.0 72 45.0 73 35.0 74 25.0 75 18.0 76 11.0 77 9.5 78 8.0 79 9.0 80 10.0 81 6.0 82 2.0 83 2.5 84 3.0 85 2.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7512742099898 96.875 2 0.9429153924566768 1.8499999999999999 3 0.1783893985728848 0.525 4 0.025484199796126403 0.1 5 0.025484199796126403 0.125 6 0.025484199796126403 0.15 7 0.025484199796126403 0.17500000000000002 8 0.025484199796126403 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 8 0.2 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 3 (100% over 50bp) CAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205105 spots for SRR6322383.sra Written 1205105 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra Read 1205101 spots for SRR6322383.sra Written 1205101 spots for SRR6322383.sra SRR ids: ['SRR6322383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aj4e0mzh SRR6322383.sra spots: 24102024 blocks: [[1, 1205101], [1205102, 2410202], [2410203, 3615303], [3615304, 4820404], [4820405, 6025505], [6025506, 7230606], [7230607, 8435707], [8435708, 9640808], [9640809, 10845909], [10845910, 12051010], [12051011, 13256111], [13256112, 14461212], [14461213, 15666313], [15666314, 16871414], [16871415, 18076515], [18076516, 19281616], [19281617, 20486717], [20486718, 21691818], [21691819, 22896919], [22896920, 24102024]] SRR6322383 file size 4190195 SRR6322383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322383 SRR6322383_1.fastq Input file: SRR6322383_1.fastq trimmed: SRR6322383-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:53:00 2024 >> started Sat Dec 7 11:53:12 2024 >> done (12.918s) 24102024 reads processed; of these: 5473 ( 0.02%) short reads filtered out after trimming by size control 41841 ( 0.17%) empty reads filtered out after trimming by size control 24054710 (99.80%) reads available; of these: 288837 ( 1.20%) trimmed reads available after processing 23765873 (98.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 257 0.00% 19 298 0.00% 20 320 0.00% 21 363 0.00% 22 459 0.00% 23 547 0.00% 24 801 0.00% 25 826 0.00% 26 815 0.00% 27 954 0.00% 28 961 0.00% 29 1037 0.00% 30 1098 0.00% 31 1370 0.01% 32 1374 0.01% 33 1529 0.01% 34 1775 0.01% 35 1952 0.01% 36 2388 0.01% 37 2828 0.01% 38 3258 0.01% 39 3979 0.02% 40 4870 0.02% 41 6118 0.03% 42 7589 0.03% 43 10098 0.04% 44 13327 0.06% 45 17722 0.07% 46 24953 0.10% 47 33831 0.14% 48 53818 0.22% 49 87322 0.36% 50 23765873 98.80% 24054710 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=11 prefix-density=0.34 prefix-fanout=1.0 sequence=TCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=23.32 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.8 sequence=GTGCTGCTGCATCTGCTCCTCCGTTGCGGATTTCTCGTAGCGGTTGTAGATGCCGCATGCCTTGCGCAGCTGCGCCTTCGTCGCGGATTTGTCGTAGCCATTGTTGACGGAGCTCCTCCCCCTGATGAGGCGGGAAAGGGAGGCTGGCATGGGAGTGTTGTTGGGAAGAGCGGACTTCCAGTATTCCTCGGCCGGAGCTCCAGTTGTTGCATCTCCGA Started job on | Dec 07 11:53:25 Started mapping on | Dec 07 11:53:25 Finished on | Dec 07 11:53:48 Mapping speed, Million of reads per hour | 3765.09 Number of input reads | 24054710 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21480240 Uniquely mapped reads % | 89.30% Average mapped length | 49.78 Number of splices: Total | 3169264 Number of splices: Annotated (sjdb) | 3054312 Number of splices: GT/AG | 3128898 Number of splices: GC/AG | 34216 Number of splices: AT/AC | 1709 Number of splices: Non-canonical | 4441 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 726843 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 1688264 % of reads mapped to too many loci | 7.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1847627 1847627 1847627 N_multimapping 726843 726843 726843 N_noFeature 1040889 20947640 1273494 N_ambiguous 326543 1236 28114 UnstrandedReadsAssigned:20112808 PositiveStrandReadsAssigned:531364 NegativeStrandReadsAssigned:20178632 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322383 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322383-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,054,710 reads, 20,113,917 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6322383.ke.tsv 35125 SRR6322383.se.tsv 88098 total ==> SRR6322383.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 59.7532 5.8601 PNS24247 1044 945 50.4724 4.38422 PNS24249 1928 1829 20.0109 0.898097 PNS24246 1044 945 50.4724 4.38422 PNS24248 1044 945 50.4724 4.38422 PNS24244 1471 1372 127.819 7.64732 PNS24243 293 194 0 0 KQK14069 1603 1504 23539.7 1284.76 KQK14071 474 375 8460.14 1851.89 ==> SRR6322383.se.tsv <== BRADI_1g14170v3 34546 BRADI_1g53295v3 152 BRADI_1g59795v3 277 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 737 BRADI_1g74790v3 276 BRADI_1g09890v3 245 BRADI_1g77505v3 197 BRADI_1g48960v3 0 SRR6322383 completed mapping pipeline successfully