Starting /dee2/code/volunteer_pipeline.sh SRR6322384 current disk space = 1543820238848 free memory = 1605745780 SRR6322384 SRAfilesize dd88659d45027892e9728fe6aa8ca91d SRR6322384.sra SRR6322384.sra file validated SRR6322384 is single end SRR6322384 is conventional basespace SRR6322384 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.14875 33.0 33.0 34.0 18.0 34.0 2 32.22225 33.0 33.0 34.0 28.0 34.0 3 32.254 34.0 33.0 34.0 28.0 34.0 4 32.4945 34.0 33.0 34.0 31.0 34.0 5 32.559 34.0 33.0 34.0 31.0 34.0 6 36.45025 38.0 37.0 38.0 34.0 38.0 7 36.736 38.0 38.0 38.0 34.0 38.0 8 36.84875 38.0 38.0 38.0 35.0 38.0 9 36.871 38.0 38.0 38.0 35.0 38.0 10 36.86125 38.0 38.0 38.0 35.0 38.0 11 36.87975 38.0 38.0 38.0 35.0 38.0 12 36.95475 38.0 38.0 38.0 35.0 38.0 13 36.9615 38.0 38.0 38.0 35.0 38.0 14 36.9655 38.0 38.0 38.0 35.0 38.0 15 37.02125 38.0 38.0 38.0 36.0 38.0 16 36.9865 38.0 38.0 38.0 35.0 38.0 17 37.04925 38.0 38.0 38.0 35.0 38.0 18 36.9665 38.0 38.0 38.0 35.0 38.0 19 36.9685 38.0 38.0 38.0 35.0 38.0 20 36.9795 38.0 38.0 38.0 36.0 38.0 21 36.94325 38.0 38.0 38.0 35.0 38.0 22 36.93 38.0 38.0 38.0 35.0 38.0 23 36.9415 38.0 38.0 38.0 36.0 38.0 24 36.93375 38.0 38.0 38.0 35.0 38.0 25 36.97 38.0 38.0 38.0 35.0 38.0 26 36.88325 38.0 38.0 38.0 35.0 38.0 27 36.891 38.0 38.0 38.0 35.0 38.0 28 36.949 38.0 38.0 38.0 35.0 38.0 29 36.89275 38.0 38.0 38.0 35.0 38.0 30 36.96275 38.0 38.0 38.0 36.0 38.0 31 36.99725 38.0 38.0 38.0 35.0 38.0 32 36.959 38.0 38.0 38.0 35.0 38.0 33 36.95725 38.0 38.0 38.0 36.0 38.0 34 36.926 38.0 38.0 38.0 35.0 38.0 35 36.8625 38.0 38.0 38.0 35.0 38.0 36 36.9725 38.0 38.0 38.0 36.0 38.0 37 36.9475 38.0 38.0 38.0 35.0 38.0 38 36.903 38.0 38.0 38.0 35.0 38.0 39 36.7975 38.0 38.0 38.0 35.0 38.0 40 36.84525 38.0 38.0 38.0 35.0 38.0 41 36.79675 38.0 38.0 38.0 35.0 38.0 42 36.8495 38.0 38.0 38.0 35.0 38.0 43 36.87 38.0 38.0 38.0 35.0 38.0 44 36.787 38.0 38.0 38.0 35.0 38.0 45 36.80625 38.0 38.0 38.0 35.0 38.0 46 36.8525 38.0 38.0 38.0 35.0 38.0 47 36.77775 38.0 38.0 38.0 35.0 38.0 48 36.7585 38.0 38.0 38.0 35.0 38.0 49 36.8725 38.0 38.0 38.0 35.0 38.0 50 36.36725 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 3.0 23 1.0 24 7.0 25 9.0 26 11.0 27 24.0 28 38.0 29 29.0 30 55.0 31 74.0 32 80.0 33 112.0 34 133.0 35 237.0 36 672.0 37 2511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.28953837749249 9.58754438677957 8.576891559683146 41.54602567604479 2 23.375 14.174999999999999 35.0 27.450000000000003 3 22.225 19.125 22.45 36.199999999999996 4 28.825 26.05 19.400000000000002 25.724999999999998 5 26.05 30.0 21.925 22.025 6 22.45 33.225 21.85 22.475 7 19.2 21.8 38.224999999999994 20.775 8 20.150000000000002 22.35 29.15 28.349999999999998 9 20.674999999999997 20.200000000000003 31.974999999999998 27.150000000000002 10 23.025000000000002 32.625 23.549999999999997 20.8 11 26.55 23.875 21.5 28.075 12 25.45 20.825 24.325 29.4 13 23.45 25.05 25.775 25.724999999999998 14 22.675 24.099999999999998 26.275 26.950000000000003 15 24.3 23.849999999999998 25.674999999999997 26.174999999999997 16 24.075 24.375 24.975 26.575 17 23.95 25.15 25.224999999999998 25.674999999999997 18 24.075 24.45 24.85 26.625 19 23.474999999999998 24.8 25.624999999999996 26.1 20 23.25 24.275 25.575 26.900000000000002 21 23.275000000000002 24.325 25.575 26.825 22 23.474999999999998 25.674999999999997 23.875 26.974999999999998 23 23.150000000000002 25.624999999999996 25.074999999999996 26.150000000000002 24 24.025 23.425 25.224999999999998 27.325 25 23.775 25.25 23.599999999999998 27.375 26 23.549999999999997 25.2 25.674999999999997 25.575 27 23.45 23.45 26.1 27.0 28 24.65 24.725 23.799999999999997 26.825 29 24.474999999999998 24.25 24.4 26.875 30 23.625 24.95 24.775 26.650000000000002 31 23.95 24.675 24.375 27.0 32 22.650000000000002 25.924999999999997 25.25 26.174999999999997 33 23.799999999999997 23.875 23.625 28.7 34 22.3 24.675 24.975 28.050000000000004 35 23.474999999999998 24.075 24.825 27.625 36 24.65 24.675 24.474999999999998 26.200000000000003 37 25.275 24.625 23.599999999999998 26.5 38 24.525 24.875 24.725 25.874999999999996 39 23.3 24.224999999999998 25.05 27.425 40 23.724999999999998 24.175 24.325 27.775 41 24.975 23.625 25.5 25.900000000000002 42 23.799999999999997 24.55 25.2 26.450000000000003 43 24.099999999999998 23.7 25.3 26.900000000000002 44 23.799999999999997 24.925 24.45 26.825 45 24.45 23.150000000000002 25.525 26.875 46 25.224999999999998 24.7 24.025 26.05 47 24.95 25.174999999999997 24.9 24.975 48 24.474999999999998 24.474999999999998 24.75 26.3 49 24.75 23.825 23.175 28.249999999999996 50 24.925 25.15 24.05 25.874999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.5 24 7.0 25 7.5 26 8.0 27 11.5 28 15.0 29 18.5 30 22.0 31 33.0 32 44.0 33 62.0 34 80.0 35 104.5 36 129.0 37 149.0 38 169.0 39 205.0 40 241.0 41 270.0 42 299.0 43 301.5 44 304.0 45 310.5 46 317.0 47 308.0 48 299.0 49 293.5 50 288.0 51 265.5 52 243.0 53 241.0 54 239.0 55 224.5 56 210.0 57 196.0 58 182.0 59 169.0 60 156.0 61 146.5 62 137.0 63 133.5 64 130.0 65 119.5 66 109.0 67 96.0 68 83.0 69 85.5 70 88.0 71 76.0 72 64.0 73 56.0 74 48.0 75 43.0 76 38.0 77 30.5 78 23.0 79 16.5 80 10.0 81 8.5 82 7.0 83 6.5 84 6.0 85 4.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.475000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525786 spots for SRR6322384.sra Written 1525786 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra Read 1525768 spots for SRR6322384.sra Written 1525768 spots for SRR6322384.sra SRR ids: ['SRR6322384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oapqez71 SRR6322384.sra spots: 30515378 blocks: [[1, 1525768], [1525769, 3051536], [3051537, 4577304], [4577305, 6103072], [6103073, 7628840], [7628841, 9154608], [9154609, 10680376], [10680377, 12206144], [12206145, 13731912], [13731913, 15257680], [15257681, 16783448], [16783449, 18309216], [18309217, 19834984], [19834985, 21360752], [21360753, 22886520], [22886521, 24412288], [24412289, 25938056], [25938057, 27463824], [27463825, 28989592], [28989593, 30515378]] SRR6322384 file size 5308055 SRR6322384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322384 SRR6322384_1.fastq Input file: SRR6322384_1.fastq trimmed: SRR6322384-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:09:26 2024 >> started Sat Dec 7 10:09:46 2024 >> done (20.014s) 30515378 reads processed; of these: 7339 ( 0.02%) short reads filtered out after trimming by size control 31682 ( 0.10%) empty reads filtered out after trimming by size control 30476357 (99.87%) reads available; of these: 405563 ( 1.33%) trimmed reads available after processing 30070794 (98.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 405 0.00% 19 413 0.00% 20 488 0.00% 21 540 0.00% 22 641 0.00% 23 734 0.00% 24 1108 0.00% 25 1216 0.00% 26 1218 0.00% 27 1297 0.00% 28 1312 0.00% 29 1486 0.00% 30 1647 0.01% 31 1839 0.01% 32 1961 0.01% 33 2229 0.01% 34 2435 0.01% 35 2882 0.01% 36 3259 0.01% 37 3938 0.01% 38 4501 0.01% 39 5608 0.02% 40 6713 0.02% 41 8458 0.03% 42 10538 0.03% 43 13762 0.05% 44 18127 0.06% 45 24665 0.08% 46 34411 0.11% 47 46837 0.15% 48 76092 0.25% 49 124803 0.41% 50 30070794 98.67% 30476357 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=13 prefix-density=0.20 prefix-fanout=3.3 sequence=TGCAGTTGTCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=102.60 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=12.2 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCAT Started job on | Dec 07 10:09:57 Started mapping on | Dec 07 10:09:59 Finished on | Dec 07 10:10:27 Mapping speed, Million of reads per hour | 3918.39 Number of input reads | 30476357 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 28743077 Uniquely mapped reads % | 94.31% Average mapped length | 49.78 Number of splices: Total | 3997726 Number of splices: Annotated (sjdb) | 3854111 Number of splices: GT/AG | 3944235 Number of splices: GC/AG | 45151 Number of splices: AT/AC | 2056 Number of splices: Non-canonical | 6284 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 788536 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 794980 % of reads mapped to too many loci | 2.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944744 944744 944744 N_multimapping 788536 788536 788536 N_noFeature 1127060 28073950 1421557 N_ambiguous 409382 1535 36566 UnstrandedReadsAssigned:27206635 PositiveStrandReadsAssigned:667592 NegativeStrandReadsAssigned:27284954 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322384 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322384-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,476,357 reads, 27,212,080 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR6322384.ke.tsv 35125 SRR6322384.se.tsv 88098 total ==> SRR6322384.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 46.9935 3.22392 PNS24247 1044 945 67.9149 4.12672 PNS24249 1928 1829 78.7754 2.47314 PNS24246 1044 945 67.9149 4.12672 PNS24248 1044 945 67.9149 4.12672 PNS24244 1471 1372 179.486 7.5119 PNS24243 293 194 0 0 KQK14069 1603 1504 39495.8 1507.91 KQK14071 474 375 14145.7 2166.03 ==> SRR6322384.se.tsv <== BRADI_1g14170v3 57008 BRADI_1g53295v3 223 BRADI_1g59795v3 359 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 1236 BRADI_1g74790v3 779 BRADI_1g09890v3 190 BRADI_1g77505v3 319 BRADI_1g48960v3 0 SRR6322384 completed mapping pipeline successfully