Starting /dee2/code/volunteer_pipeline.sh SRR6322385 current disk space = 1543861800960 free memory = 1605868032 SRR6322385 SRAfilesize 71486146a55c8cb793402fc7409fbb08 SRR6322385.sra SRR6322385.sra file validated SRR6322385 is single end SRR6322385 is conventional basespace SRR6322385 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52975 33.0 33.0 34.0 25.0 34.0 2 32.32625 34.0 33.0 34.0 28.0 34.0 3 32.456 34.0 33.0 34.0 28.0 34.0 4 32.68125 34.0 33.0 34.0 32.0 34.0 5 32.64475 34.0 33.0 34.0 32.0 34.0 6 36.4915 38.0 37.0 38.0 34.0 38.0 7 36.78025 38.0 38.0 38.0 34.0 38.0 8 36.95075 38.0 38.0 38.0 36.0 38.0 9 36.878 38.0 38.0 38.0 35.0 38.0 10 36.94125 38.0 38.0 38.0 35.0 38.0 11 37.0175 38.0 38.0 38.0 35.0 38.0 12 37.03775 38.0 38.0 38.0 36.0 38.0 13 37.00825 38.0 38.0 38.0 36.0 38.0 14 37.0995 38.0 38.0 38.0 36.0 38.0 15 37.02825 38.0 38.0 38.0 36.0 38.0 16 37.072 38.0 38.0 38.0 36.0 38.0 17 37.019 38.0 38.0 38.0 36.0 38.0 18 37.148 38.0 38.0 38.0 36.0 38.0 19 37.18625 38.0 38.0 38.0 36.0 38.0 20 37.14975 38.0 38.0 38.0 36.0 38.0 21 37.0475 38.0 38.0 38.0 36.0 38.0 22 37.0845 38.0 38.0 38.0 36.0 38.0 23 37.15275 38.0 38.0 38.0 36.0 38.0 24 37.12625 38.0 38.0 38.0 36.0 38.0 25 37.07275 38.0 38.0 38.0 36.0 38.0 26 37.11375 38.0 38.0 38.0 36.0 38.0 27 37.05875 38.0 38.0 38.0 36.0 38.0 28 37.05375 38.0 38.0 38.0 36.0 38.0 29 37.05025 38.0 38.0 38.0 36.0 38.0 30 37.03275 38.0 38.0 38.0 36.0 38.0 31 37.11825 38.0 38.0 38.0 36.0 38.0 32 37.076 38.0 38.0 38.0 36.0 38.0 33 37.0595 38.0 38.0 38.0 36.0 38.0 34 37.12875 38.0 38.0 38.0 36.0 38.0 35 37.02325 38.0 38.0 38.0 36.0 38.0 36 37.1145 38.0 38.0 38.0 36.0 38.0 37 37.0825 38.0 38.0 38.0 36.0 38.0 38 36.96975 38.0 38.0 38.0 36.0 38.0 39 36.94475 38.0 38.0 38.0 35.0 38.0 40 36.93575 38.0 38.0 38.0 36.0 38.0 41 36.96225 38.0 38.0 38.0 36.0 38.0 42 37.053 38.0 38.0 38.0 36.0 38.0 43 37.0935 38.0 38.0 38.0 36.0 38.0 44 37.066 38.0 38.0 38.0 36.0 38.0 45 36.98725 38.0 38.0 38.0 36.0 38.0 46 36.94225 38.0 38.0 38.0 36.0 38.0 47 36.857 38.0 38.0 38.0 35.0 38.0 48 36.8735 38.0 38.0 38.0 36.0 38.0 49 36.93675 38.0 38.0 38.0 36.0 38.0 50 36.61725 38.0 38.0 38.0 35.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 4.0 25 6.0 26 14.0 27 13.0 28 20.0 29 43.0 30 55.0 31 62.0 32 60.0 33 89.0 34 118.0 35 228.0 36 688.0 37 2595.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.79507975128413 9.89456609894566 9.462016761286835 38.84833738848337 2 23.125 14.649999999999999 33.1 29.125 3 21.099999999999998 20.150000000000002 23.825 34.925 4 28.825 26.424999999999997 20.95 23.799999999999997 5 26.200000000000003 30.599999999999998 22.075 21.125 6 22.25 32.9 23.849999999999998 21.0 7 17.95 22.85 38.875 20.325 8 20.974999999999998 21.6 29.099999999999998 28.325 9 20.925 22.25 31.25 25.575 10 22.45 34.150000000000006 23.875 19.525000000000002 11 25.15 24.875 19.775000000000002 30.2 12 23.225 22.125 26.525 28.125 13 22.0 26.200000000000003 26.724999999999998 25.074999999999996 14 21.575 25.900000000000002 27.6 24.925 15 22.425 24.425 27.725 25.424999999999997 16 24.474999999999998 23.1 26.450000000000003 25.974999999999998 17 23.375 26.05 25.724999999999998 24.85 18 22.925 25.15 26.525 25.4 19 23.325000000000003 26.8 23.974999999999998 25.900000000000002 20 21.8 26.325 25.674999999999997 26.200000000000003 21 24.3 25.650000000000002 25.1 24.95 22 22.75 26.950000000000003 25.3 25.0 23 24.4 25.05 24.4 26.150000000000002 24 22.05 26.375 24.8 26.775 25 23.025000000000002 26.525 24.425 26.025 26 22.55 26.3 25.25 25.900000000000002 27 23.849999999999998 24.85 25.75 25.55 28 25.424999999999997 23.65 25.025 25.900000000000002 29 23.599999999999998 25.525 24.975 25.900000000000002 30 21.675 26.400000000000002 25.7 26.224999999999998 31 24.349999999999998 24.325 25.374999999999996 25.95 32 23.65 25.174999999999997 25.924999999999997 25.25 33 23.724999999999998 23.974999999999998 25.95 26.35 34 24.575 25.7 24.325 25.4 35 23.9 25.75 25.4 24.95 36 21.45 25.674999999999997 25.275 27.6 37 23.1 26.700000000000003 25.0 25.2 38 22.425 25.1 26.224999999999998 26.25 39 23.325000000000003 25.074999999999996 24.15 27.450000000000003 40 22.575 25.85 25.4 26.174999999999997 41 23.7 25.55 26.375 24.375 42 23.549999999999997 26.125 24.575 25.75 43 24.65 24.125 25.900000000000002 25.324999999999996 44 22.736368184092047 24.96248124062031 27.388694347173587 24.912456228114056 45 23.775 24.25 26.55 25.424999999999997 46 24.137068534267133 25.63781890945473 24.487243621810904 25.737868934467233 47 24.4 24.95 26.3 24.349999999999998 48 23.45 25.25 23.974999999999998 27.325 49 22.475 24.65 26.125 26.75 50 22.675 24.075 26.075 27.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 3.0 19 2.5 20 2.0 21 2.0 22 2.0 23 7.0 24 12.0 25 12.5 26 13.0 27 18.5 28 24.0 29 32.0 30 40.0 31 55.0 32 70.0 33 77.5 34 85.0 35 107.0 36 129.0 37 166.0 38 203.0 39 220.5 40 238.0 41 264.5 42 291.0 43 300.0 44 309.0 45 298.5 46 288.0 47 301.5 48 315.0 49 312.5 50 310.0 51 303.0 52 296.0 53 267.5 54 239.0 55 232.5 56 226.0 57 203.5 58 181.0 59 168.0 60 155.0 61 152.5 62 150.0 63 133.0 64 116.0 65 108.0 66 100.0 67 82.0 68 64.0 69 56.5 70 49.0 71 45.5 72 42.0 73 30.0 74 18.0 75 15.0 76 12.0 77 12.0 78 12.0 79 7.0 80 2.0 81 1.5 82 1.0 83 1.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.05 45 0.0 46 0.05 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 96.1121396455964 90.85 2 3.0944194657498016 5.8500000000000005 3 0.42316847394869084 1.2 4 0.10579211848717271 0.4 5 0.10579211848717271 0.5 6 0.07934408886537953 0.44999999999999996 7 0.0 0.0 8 0.026448029621793177 0.2 9 0.0 0.0 >10 0.052896059243586355 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 12 0.3 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC 10 0.25 TruSeq Adapter, Index 1 (100% over 50bp) GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCA 8 0.2 No Hit CTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCAGG 6 0.15 No Hit CAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGC 6 0.15 No Hit CATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAAT 6 0.15 No Hit GTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTCGCG 5 0.125 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit ACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTCGCGACG 5 0.125 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra Read 1334462 spots for SRR6322385.sra Written 1334462 spots for SRR6322385.sra Read 1334458 spots for SRR6322385.sra Written 1334458 spots for SRR6322385.sra SRR ids: ['SRR6322385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s6ekq55z SRR6322385.sra spots: 26689164 blocks: [[1, 1334458], [1334459, 2668916], [2668917, 4003374], [4003375, 5337832], [5337833, 6672290], [6672291, 8006748], [8006749, 9341206], [9341207, 10675664], [10675665, 12010122], [12010123, 13344580], [13344581, 14679038], [14679039, 16013496], [16013497, 17347954], [17347955, 18682412], [18682413, 20016870], [20016871, 21351328], [21351329, 22685786], [22685787, 24020244], [24020245, 25354702], [25354703, 26689164]] SRR6322385 file size 4641141 SRR6322385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322385 SRR6322385_1.fastq Input file: SRR6322385_1.fastq trimmed: SRR6322385-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:11:19 2024 >> started Sat Dec 7 10:11:29 2024 >> done (10.210s) 26689164 reads processed; of these: 7048 ( 0.03%) short reads filtered out after trimming by size control 71583 ( 0.27%) empty reads filtered out after trimming by size control 26610533 (99.71%) reads available; of these: 303976 ( 1.14%) trimmed reads available after processing 26306557 (98.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 327 0.00% 19 315 0.00% 20 382 0.00% 21 393 0.00% 22 544 0.00% 23 559 0.00% 24 893 0.00% 25 937 0.00% 26 922 0.00% 27 991 0.00% 28 941 0.00% 29 1101 0.00% 30 1232 0.00% 31 1477 0.01% 32 1529 0.01% 33 1652 0.01% 34 1886 0.01% 35 2157 0.01% 36 2654 0.01% 37 2957 0.01% 38 3596 0.01% 39 4343 0.02% 40 5101 0.02% 41 6540 0.02% 42 8118 0.03% 43 10651 0.04% 44 14153 0.05% 45 18951 0.07% 46 25793 0.10% 47 35444 0.13% 48 55925 0.21% 49 91512 0.34% 50 26306557 98.86% 26610533 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=19 prefix-density=0.80 prefix-fanout=2.0 sequence=TCCACGCTTTTGGGGATGGAGACGAAGGTTCCAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=14.36 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=1.6 sequence=TTGAACATGGAGAAGATGTACGTCTCGATGGCGCCCGGGTGGCGCGGCGTGCCGCGGGCGACGTGCTTGACGAGGTACTGGTTGTAGATCCTTGCGTTTTCCGGCGATGCCGCCACGCCGCCGGCTGAAGGCCACCCGCTCTCGGACACCACGAGCTTCACATTAGACCCGCCGTTGTACCTGGCCA Started job on | Dec 07 10:11:39 Started mapping on | Dec 07 10:11:39 Finished on | Dec 07 10:12:11 Mapping speed, Million of reads per hour | 2993.68 Number of input reads | 26610533 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21904360 Uniquely mapped reads % | 82.31% Average mapped length | 49.79 Number of splices: Total | 3360178 Number of splices: Annotated (sjdb) | 3240509 Number of splices: GT/AG | 3324348 Number of splices: GC/AG | 29707 Number of splices: AT/AC | 995 Number of splices: Non-canonical | 5128 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 837548 % of reads mapped to multiple loci | 3.15% Number of reads mapped to too many loci | 3655920 % of reads mapped to too many loci | 13.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3868625 3868625 3868625 N_multimapping 837548 837548 837548 N_noFeature 1520335 21311472 1787842 N_ambiguous 342452 778 17801 UnstrandedReadsAssigned:20041573 PositiveStrandReadsAssigned:592110 NegativeStrandReadsAssigned:20098717 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322385 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322385-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,610,533 reads, 20,045,961 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR6322385.ke.tsv 35125 SRR6322385.se.tsv 88098 total ==> SRR6322385.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.36624 0.832792 PNS24247 1044 945 107.633 10.7778 PNS24249 1928 1829 25.6797 1.32859 PNS24246 1044 945 107.633 10.7778 PNS24248 1044 945 107.633 10.7778 PNS24244 1471 1372 231.055 15.9359 PNS24243 293 194 1 0.487769 KQK14069 1603 1504 2814.35 177.071 KQK14071 474 375 833.847 210.412 ==> SRR6322385.se.tsv <== BRADI_1g14170v3 4207 BRADI_1g53295v3 197 BRADI_1g59795v3 225 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 2236 BRADI_1g74790v3 6 BRADI_1g09890v3 0 BRADI_1g77505v3 57 BRADI_1g48960v3 0 SRR6322385 completed mapping pipeline successfully