Starting /dee2/code/volunteer_pipeline.sh SRR6322386 current disk space = 1543862738944 free memory = 1597174996 SRR6322386 SRAfilesize d63a0a3f4c16b2982ee4f08c51ba6016 SRR6322386.sra SRR6322386.sra file validated SRR6322386 is single end SRR6322386 is conventional basespace SRR6322386 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.14275 33.0 33.0 34.0 18.0 34.0 2 32.2935 33.0 33.0 34.0 28.0 34.0 3 32.3435 34.0 32.0 34.0 28.0 34.0 4 32.58125 33.0 33.0 34.0 31.0 34.0 5 32.513 33.0 33.0 34.0 31.0 34.0 6 36.387 38.0 37.0 38.0 33.0 38.0 7 36.696 38.0 38.0 38.0 34.0 38.0 8 36.77625 38.0 38.0 38.0 35.0 38.0 9 36.777 38.0 38.0 38.0 35.0 38.0 10 36.86775 38.0 38.0 38.0 35.0 38.0 11 36.90375 38.0 38.0 38.0 35.0 38.0 12 36.9555 38.0 38.0 38.0 35.0 38.0 13 36.83575 38.0 38.0 38.0 35.0 38.0 14 36.911 38.0 38.0 38.0 35.0 38.0 15 36.983 38.0 38.0 38.0 35.0 38.0 16 36.977 38.0 38.0 38.0 35.0 38.0 17 36.94 38.0 38.0 38.0 35.0 38.0 18 36.9745 38.0 38.0 38.0 35.0 38.0 19 36.97625 38.0 38.0 38.0 35.0 38.0 20 36.978 38.0 38.0 38.0 35.0 38.0 21 36.89075 38.0 38.0 38.0 35.0 38.0 22 36.875 38.0 38.0 38.0 35.0 38.0 23 36.95725 38.0 38.0 38.0 35.0 38.0 24 36.9125 38.0 38.0 38.0 35.0 38.0 25 36.8665 38.0 38.0 38.0 35.0 38.0 26 36.87 38.0 38.0 38.0 35.0 38.0 27 36.8455 38.0 38.0 38.0 35.0 38.0 28 36.85 38.0 38.0 38.0 35.0 38.0 29 36.845 38.0 38.0 38.0 35.0 38.0 30 36.8785 38.0 38.0 38.0 35.0 38.0 31 36.939 38.0 38.0 38.0 36.0 38.0 32 36.93875 38.0 38.0 38.0 35.0 38.0 33 36.916 38.0 38.0 38.0 35.0 38.0 34 36.85125 38.0 38.0 38.0 35.0 38.0 35 36.814 38.0 38.0 38.0 35.0 38.0 36 36.89675 38.0 38.0 38.0 35.0 38.0 37 36.8785 38.0 38.0 38.0 35.0 38.0 38 36.784 38.0 38.0 38.0 35.0 38.0 39 36.8285 38.0 38.0 38.0 35.0 38.0 40 36.85225 38.0 38.0 38.0 35.0 38.0 41 36.81625 38.0 38.0 38.0 35.0 38.0 42 36.8895 38.0 38.0 38.0 35.0 38.0 43 36.89 38.0 38.0 38.0 35.0 38.0 44 36.9155 38.0 38.0 38.0 35.0 38.0 45 36.88775 38.0 38.0 38.0 35.0 38.0 46 36.825 38.0 38.0 38.0 35.0 38.0 47 36.77 38.0 38.0 38.0 35.0 38.0 48 36.63625 38.0 38.0 38.0 35.0 38.0 49 36.67575 38.0 38.0 38.0 35.0 38.0 50 36.38625 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 4.0 22 2.0 23 4.0 24 8.0 25 15.0 26 10.0 27 18.0 28 35.0 29 29.0 30 57.0 31 53.0 32 89.0 33 121.0 34 153.0 35 241.0 36 653.0 37 2506.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.932915189528224 8.671938914644123 9.135533133351514 44.25961276247614 2 23.925 13.325000000000001 33.125 29.625 3 22.025 19.7 21.975 36.3 4 27.250000000000004 25.900000000000002 19.950000000000003 26.900000000000002 5 27.325 30.0 21.224999999999998 21.45 6 22.375 31.8 22.925 22.900000000000002 7 20.05 21.775 37.675 20.5 8 21.425 22.325 27.500000000000004 28.749999999999996 9 21.775 21.525 30.7 26.0 10 23.974999999999998 33.575 21.625 20.825 11 27.1 23.175 20.375 29.349999999999998 12 25.45 20.625 24.6 29.325000000000003 13 23.599999999999998 23.025000000000002 26.025 27.35 14 24.4 24.4 25.7 25.5 15 24.0 24.425 23.45 28.125 16 24.95 23.5 23.9 27.650000000000002 17 23.799999999999997 25.374999999999996 24.224999999999998 26.6 18 24.825 23.325000000000003 26.575 25.275 19 24.975 24.5 22.900000000000002 27.625 20 25.424999999999997 24.45 23.825 26.3 21 24.975 24.55 24.6 25.874999999999996 22 25.0 24.85 23.799999999999997 26.35 23 25.374999999999996 24.75 24.075 25.8 24 24.325 24.45 24.275 26.950000000000003 25 25.55 23.7 23.025000000000002 27.725 26 23.425 25.0 23.075000000000003 28.499999999999996 27 22.95 24.85 25.324999999999996 26.875 28 24.875 24.15 23.75 27.224999999999998 29 24.325 24.4 24.45 26.825 30 24.875 23.825 23.375 27.925 31 25.7 23.549999999999997 23.45 27.3 32 25.4 23.974999999999998 24.95 25.674999999999997 33 24.675 23.275000000000002 23.674999999999997 28.375 34 25.05 25.275 22.35 27.325 35 25.05 26.025 23.3 25.624999999999996 36 23.599999999999998 25.35 24.099999999999998 26.950000000000003 37 25.424999999999997 24.099999999999998 24.2 26.275 38 24.95 23.875 24.224999999999998 26.950000000000003 39 23.849999999999998 23.849999999999998 23.7 28.599999999999998 40 23.95 24.4 23.775 27.875 41 23.799999999999997 24.575 24.7 26.924999999999997 42 23.075000000000003 23.7 25.275 27.950000000000003 43 25.575 24.0 24.0 26.424999999999997 44 25.374999999999996 23.7 23.724999999999998 27.200000000000003 45 24.45 23.775 23.599999999999998 28.175 46 25.75 23.95 22.75 27.55 47 25.2 23.225 24.55 27.025 48 22.75 24.9 25.45 26.900000000000002 49 24.025 24.15 24.65 27.175 50 24.85 24.275 24.275 26.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 5.0 24 8.0 25 7.0 26 6.0 27 10.5 28 15.0 29 28.5 30 42.0 31 42.0 32 42.0 33 55.0 34 68.0 35 87.0 36 106.0 37 134.0 38 162.0 39 177.0 40 192.0 41 219.0 42 246.0 43 266.5 44 287.0 45 305.0 46 323.0 47 312.0 48 301.0 49 300.0 50 299.0 51 269.0 52 239.0 53 241.0 54 243.0 55 218.5 56 194.0 57 188.0 58 182.0 59 171.0 60 160.0 61 160.5 62 161.0 63 146.5 64 132.0 65 138.5 66 145.0 67 132.0 68 119.0 69 103.5 70 88.0 71 77.5 72 67.0 73 64.5 74 62.0 75 49.5 76 37.0 77 34.5 78 32.0 79 29.5 80 27.0 81 17.0 82 7.0 83 5.5 84 4.0 85 2.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.325000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98708533806027 97.725 2 0.8863003291972652 1.7500000000000002 3 0.05064573309698658 0.15 4 0.02532286654849329 0.1 5 0.02532286654849329 0.125 6 0.02532286654849329 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 6 0.15 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra Read 1374789 spots for SRR6322386.sra Written 1374789 spots for SRR6322386.sra SRR ids: ['SRR6322386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zjcy0jh5 SRR6322386.sra spots: 27495780 blocks: [[1, 1374789], [1374790, 2749578], [2749579, 4124367], [4124368, 5499156], [5499157, 6873945], [6873946, 8248734], [8248735, 9623523], [9623524, 10998312], [10998313, 12373101], [12373102, 13747890], [13747891, 15122679], [15122680, 16497468], [16497469, 17872257], [17872258, 19247046], [19247047, 20621835], [20621836, 21996624], [21996625, 23371413], [23371414, 24746202], [24746203, 26120991], [26120992, 27495780]] SRR6322386 file size 4781731 SRR6322386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322386 SRR6322386_1.fastq Input file: SRR6322386_1.fastq trimmed: SRR6322386-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:11:41 2024 >> started Sat Dec 7 10:11:58 2024 >> done (16.716s) 27495780 reads processed; of these: 9994 ( 0.04%) short reads filtered out after trimming by size control 64458 ( 0.23%) empty reads filtered out after trimming by size control 27421328 (99.73%) reads available; of these: 380531 ( 1.39%) trimmed reads available after processing 27040797 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 470 0.00% 19 428 0.00% 20 529 0.00% 21 574 0.00% 22 682 0.00% 23 771 0.00% 24 1119 0.00% 25 1264 0.00% 26 1287 0.00% 27 1289 0.00% 28 1349 0.00% 29 1499 0.01% 30 1605 0.01% 31 1795 0.01% 32 1942 0.01% 33 2146 0.01% 34 2338 0.01% 35 2722 0.01% 36 3009 0.01% 37 3702 0.01% 38 4412 0.02% 39 5275 0.02% 40 6661 0.02% 41 7959 0.03% 42 9858 0.04% 43 13071 0.05% 44 17113 0.06% 45 23176 0.08% 46 31822 0.12% 47 43774 0.16% 48 70595 0.26% 49 116295 0.42% 50 27040797 98.61% 27421328 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=25 prefix-density=0.15 prefix-fanout=1.1 sequence=TTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=134.65 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=17.4 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGATTGATCTGTGTGT Started job on | Dec 07 10:12:09 Started mapping on | Dec 07 10:12:09 Finished on | Dec 07 10:12:33 Mapping speed, Million of reads per hour | 4113.20 Number of input reads | 27421328 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 25286644 Uniquely mapped reads % | 92.22% Average mapped length | 49.78 Number of splices: Total | 3780607 Number of splices: Annotated (sjdb) | 3629448 Number of splices: GT/AG | 3679544 Number of splices: GC/AG | 92600 Number of splices: AT/AC | 2293 Number of splices: Non-canonical | 6170 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 693307 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 1244748 % of reads mapped to too many loci | 4.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1441377 1441377 1441377 N_multimapping 693307 693307 693307 N_noFeature 1061138 24616588 1346894 N_ambiguous 413053 1390 29913 UnstrandedReadsAssigned:23812453 PositiveStrandReadsAssigned:668666 NegativeStrandReadsAssigned:23909837 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322386 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322386-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,421,328 reads, 23,782,097 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR6322386.ke.tsv 35125 SRR6322386.se.tsv 88098 total ==> SRR6322386.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 116.518 9.08009 PNS24247 1044 945 57.1138 3.94214 PNS24249 1928 1829 249.687 8.90441 PNS24246 1044 945 57.1138 3.94214 PNS24248 1044 945 57.1138 3.94214 PNS24244 1471 1372 38.4536 1.82812 PNS24243 293 194 0 0 KQK14069 1603 1504 26511.5 1149.77 KQK14071 474 375 9506.69 1653.56 ==> SRR6322386.se.tsv <== BRADI_1g14170v3 39355 BRADI_1g53295v3 269 BRADI_1g59795v3 510 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 1329 BRADI_1g74790v3 286 BRADI_1g09890v3 0 BRADI_1g77505v3 420 BRADI_1g48960v3 1 SRR6322386 completed mapping pipeline successfully