Starting /dee2/code/volunteer_pipeline.sh SRR6322387 current disk space = 1543870627840 free memory = 1597023132 SRR6322387 SRAfilesize 14994068cbe38e7e35c6307f6c216524 SRR6322387.sra SRR6322387.sra file validated SRR6322387 is single end SRR6322387 is conventional basespace SRR6322387 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.17375 33.0 32.0 34.0 2.0 34.0 2 31.99075 34.0 32.0 34.0 27.0 34.0 3 32.32175 34.0 32.0 34.0 27.0 34.0 4 32.79725 34.0 33.0 34.0 32.0 34.0 5 32.86675 34.0 33.0 34.0 32.0 34.0 6 36.703 38.0 37.0 38.0 34.0 38.0 7 37.1575 38.0 38.0 38.0 36.0 38.0 8 37.34775 38.0 38.0 38.0 37.0 38.0 9 37.295 38.0 38.0 38.0 37.0 38.0 10 37.327 38.0 38.0 38.0 37.0 38.0 11 37.3815 38.0 38.0 38.0 37.0 38.0 12 37.3185 38.0 38.0 38.0 37.0 38.0 13 37.34875 38.0 38.0 38.0 37.0 38.0 14 37.3565 38.0 38.0 38.0 37.0 38.0 15 37.42625 38.0 38.0 38.0 37.0 38.0 16 37.296 38.0 38.0 38.0 37.0 38.0 17 37.33375 38.0 38.0 38.0 37.0 38.0 18 37.33025 38.0 38.0 38.0 37.0 38.0 19 37.32325 38.0 38.0 38.0 37.0 38.0 20 37.28475 38.0 38.0 38.0 37.0 38.0 21 37.318 38.0 38.0 38.0 37.0 38.0 22 37.3175 38.0 38.0 38.0 37.0 38.0 23 37.31025 38.0 38.0 38.0 37.0 38.0 24 37.35325 38.0 38.0 38.0 37.0 38.0 25 37.246 38.0 38.0 38.0 37.0 38.0 26 37.25525 38.0 38.0 38.0 37.0 38.0 27 37.302 38.0 38.0 38.0 37.0 38.0 28 37.192 38.0 38.0 38.0 37.0 38.0 29 37.234 38.0 38.0 38.0 37.0 38.0 30 37.089 38.0 38.0 38.0 36.0 38.0 31 37.283 38.0 38.0 38.0 37.0 38.0 32 37.11475 38.0 38.0 38.0 36.0 38.0 33 37.0985 38.0 38.0 38.0 36.0 38.0 34 37.17025 38.0 38.0 38.0 37.0 38.0 35 37.1625 38.0 38.0 38.0 37.0 38.0 36 37.19675 38.0 38.0 38.0 36.0 38.0 37 37.109 38.0 38.0 38.0 36.0 38.0 38 37.1485 38.0 38.0 38.0 37.0 38.0 39 37.1455 38.0 38.0 38.0 37.0 38.0 40 37.0585 38.0 38.0 38.0 36.0 38.0 41 37.19425 38.0 38.0 38.0 37.0 38.0 42 37.175 38.0 38.0 38.0 37.0 38.0 43 37.1415 38.0 38.0 38.0 37.0 38.0 44 37.19075 38.0 38.0 38.0 37.0 38.0 45 37.101 38.0 38.0 38.0 37.0 38.0 46 37.1255 38.0 38.0 38.0 37.0 38.0 47 36.99625 38.0 38.0 38.0 36.0 38.0 48 36.997 38.0 38.0 38.0 36.0 38.0 49 37.10025 38.0 38.0 38.0 36.0 38.0 50 37.09975 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 2.0 24 0.0 25 5.0 26 9.0 27 14.0 28 16.0 29 27.0 30 34.0 31 40.0 32 49.0 33 83.0 34 93.0 35 212.0 36 821.0 37 2587.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.33984606275903 9.917110716400236 9.473060982830077 46.26998223801066 2 24.224999999999998 12.049999999999999 32.05 31.674999999999997 3 20.625 13.25 23.525 42.6 4 25.75 18.775 21.425 34.050000000000004 5 29.275000000000002 24.075 22.6 24.05 6 25.15 27.325 23.599999999999998 23.925 7 19.725 24.349999999999998 34.775 21.15 8 21.4 23.974999999999998 28.675 25.95 9 21.075 21.6 32.324999999999996 25.0 10 22.05 31.574999999999996 25.4 20.974999999999998 11 25.45 25.0 21.95 27.6 12 23.775 20.5 26.650000000000002 29.075 13 22.8 24.725 26.325 26.150000000000002 14 22.625 24.25 26.275 26.85 15 22.900000000000002 25.624999999999996 24.474999999999998 27.0 16 24.15 23.45 23.5 28.9 17 24.099999999999998 24.05 25.4 26.450000000000003 18 22.85 24.099999999999998 25.85 27.200000000000003 19 24.55 22.575 24.875 28.000000000000004 20 23.225 24.65 25.55 26.575 21 23.799999999999997 24.55 24.95 26.700000000000003 22 23.625 25.474999999999998 24.224999999999998 26.674999999999997 23 23.150000000000002 26.3 25.650000000000002 24.9 24 23.175 25.1 24.525 27.200000000000003 25 24.25 24.325 23.849999999999998 27.575 26 21.625 25.45 24.95 27.975 27 22.825 24.95 25.3 26.924999999999997 28 24.5 24.15 23.075000000000003 28.275 29 25.224999999999998 24.474999999999998 24.125 26.174999999999997 30 23.400000000000002 23.849999999999998 25.25 27.500000000000004 31 24.349999999999998 23.65 23.549999999999997 28.449999999999996 32 24.05 25.474999999999998 24.25 26.224999999999998 33 24.075 23.05 24.975 27.900000000000002 34 25.45 24.825 24.075 25.650000000000002 35 23.625 24.45 24.349999999999998 27.575 36 24.325 22.95 25.8 26.924999999999997 37 24.125 24.975 23.150000000000002 27.750000000000004 38 23.925 24.375 25.7 26.0 39 23.525 24.05 24.325 28.1 40 23.9 24.55 23.25 28.299999999999997 41 24.15 23.325000000000003 26.974999999999998 25.55 42 23.1 23.674999999999997 24.474999999999998 28.749999999999996 43 24.6 25.224999999999998 23.325000000000003 26.85 44 23.974999999999998 26.224999999999998 23.125 26.674999999999997 45 22.95 23.35 25.275 28.425 46 23.425 24.575 24.65 27.35 47 25.474999999999998 25.624999999999996 23.200000000000003 25.7 48 23.175 25.7 24.7 26.424999999999997 49 25.7 23.125 24.0 27.175 50 23.974999999999998 25.324999999999996 24.525 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 2.5 24 5.0 25 8.0 26 11.0 27 10.5 28 10.0 29 17.0 30 24.0 31 35.0 32 46.0 33 58.0 34 70.0 35 99.5 36 129.0 37 147.5 38 166.0 39 178.0 40 190.0 41 229.5 42 269.0 43 288.5 44 308.0 45 308.0 46 308.0 47 288.5 48 269.0 49 278.5 50 288.0 51 292.5 52 297.0 53 269.0 54 241.0 55 241.0 56 241.0 57 203.5 58 166.0 59 171.0 60 176.0 61 164.5 62 153.0 63 148.0 64 143.0 65 132.5 66 122.0 67 104.0 68 86.0 69 91.0 70 96.0 71 80.5 72 65.0 73 56.5 74 48.0 75 36.0 76 24.0 77 24.5 78 25.0 79 18.5 80 12.0 81 8.5 82 5.0 83 4.5 84 4.0 85 2.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36740890688259 98.175 2 0.5566801619433198 1.0999999999999999 3 0.025303643724696356 0.075 4 0.025303643724696356 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025303643724696356 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 22 0.5499999999999999 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292790 spots for SRR6322387.sra Written 1292790 spots for SRR6322387.sra Read 1292792 spots for SRR6322387.sra Written 1292792 spots for SRR6322387.sra SRR ids: ['SRR6322387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6iqzppu0 SRR6322387.sra spots: 25855802 blocks: [[1, 1292790], [1292791, 2585580], [2585581, 3878370], [3878371, 5171160], [5171161, 6463950], [6463951, 7756740], [7756741, 9049530], [9049531, 10342320], [10342321, 11635110], [11635111, 12927900], [12927901, 14220690], [14220691, 15513480], [15513481, 16806270], [16806271, 18099060], [18099061, 19391850], [19391851, 20684640], [20684641, 21977430], [21977431, 23270220], [23270221, 24563010], [24563011, 25855802]] SRR6322387 file size 4495846 SRR6322387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322387 SRR6322387_1.fastq Input file: SRR6322387_1.fastq trimmed: SRR6322387-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:12:39 2024 >> started Sat Dec 7 10:12:50 2024 >> done (11.906s) 25855802 reads processed; of these: 6138 ( 0.02%) short reads filtered out after trimming by size control 232869 ( 0.90%) empty reads filtered out after trimming by size control 25616795 (99.08%) reads available; of these: 220232 ( 0.86%) trimmed reads available after processing 25396563 (99.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 338 0.00% 19 351 0.00% 20 380 0.00% 21 436 0.00% 22 550 0.00% 23 691 0.00% 24 4003 0.02% 25 3129 0.01% 26 2257 0.01% 27 1529 0.01% 28 944 0.00% 29 1020 0.00% 30 1218 0.00% 31 1155 0.00% 32 1144 0.00% 33 1310 0.01% 34 1490 0.01% 35 1606 0.01% 36 1841 0.01% 37 2069 0.01% 38 2448 0.01% 39 2848 0.01% 40 3675 0.01% 41 4499 0.02% 42 5596 0.02% 43 7384 0.03% 44 10047 0.04% 45 13019 0.05% 46 18231 0.07% 47 25661 0.10% 48 40513 0.16% 49 58850 0.23% 50 25396563 99.14% 25616795 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.17 prefix-fanout=2.0 sequence=CCTGCAGTTGTCGCAGCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=29.18 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=5.5 sequence=CCGCCGCCGCCA Started job on | Dec 07 10:13:04 Started mapping on | Dec 07 10:13:04 Finished on | Dec 07 10:13:37 Mapping speed, Million of reads per hour | 2794.56 Number of input reads | 25616795 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 24474172 Uniquely mapped reads % | 95.54% Average mapped length | 49.74 Number of splices: Total | 3396345 Number of splices: Annotated (sjdb) | 3256370 Number of splices: GT/AG | 3353252 Number of splices: GC/AG | 35930 Number of splices: AT/AC | 1919 Number of splices: Non-canonical | 5244 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 651070 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 355719 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 491553 491553 491553 N_multimapping 651070 651070 651070 N_noFeature 1012753 23919500 1188539 N_ambiguous 408081 1264 29697 UnstrandedReadsAssigned:23053338 PositiveStrandReadsAssigned:553408 NegativeStrandReadsAssigned:23255936 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322387 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322387-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,616,795 reads, 23,137,155 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6322387.ke.tsv 35125 SRR6322387.se.tsv 88098 total ==> SRR6322387.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 50.2421 4.04973 PNS24247 1044 945 106.021 7.56906 PNS24249 1928 1829 70.5985 2.60414 PNS24246 1044 945 106.021 7.56906 PNS24248 1044 945 106.021 7.56906 PNS24244 1471 1372 147.097 7.23325 PNS24243 293 194 0 0 KQK14069 1603 1504 9555.08 428.617 KQK14071 474 375 3701.39 665.912 ==> SRR6322387.se.tsv <== BRADI_1g14170v3 14278 BRADI_1g53295v3 326 BRADI_1g59795v3 322 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 3021 BRADI_1g74790v3 609 BRADI_1g09890v3 0 BRADI_1g77505v3 252 BRADI_1g48960v3 0 SRR6322387 completed mapping pipeline successfully