Starting /dee2/code/volunteer_pipeline.sh SRR6322388 current disk space = 1543110598656 free memory = 1603836264 SRR6322388 SRAfilesize 58d478519d70db1a42c20da3a0304e5d SRR6322388.sra SRR6322388.sra file validated SRR6322388 is single end SRR6322388 is conventional basespace SRR6322388 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.67775 33.0 32.0 34.0 2.0 34.0 2 32.0655 34.0 32.0 34.0 27.0 34.0 3 32.352 34.0 32.0 34.0 28.0 34.0 4 32.677 34.0 33.0 34.0 32.0 34.0 5 32.81275 34.0 33.0 34.0 32.0 34.0 6 36.64025 38.0 37.0 38.0 34.0 38.0 7 37.0755 38.0 38.0 38.0 36.0 38.0 8 37.19475 38.0 38.0 38.0 36.0 38.0 9 37.2595 38.0 38.0 38.0 37.0 38.0 10 37.3215 38.0 38.0 38.0 37.0 38.0 11 37.345 38.0 38.0 38.0 37.0 38.0 12 37.31625 38.0 38.0 38.0 37.0 38.0 13 37.324 38.0 38.0 38.0 37.0 38.0 14 37.319 38.0 38.0 38.0 37.0 38.0 15 37.2805 38.0 38.0 38.0 37.0 38.0 16 37.27925 38.0 38.0 38.0 37.0 38.0 17 37.266 38.0 38.0 38.0 37.0 38.0 18 37.29125 38.0 38.0 38.0 37.0 38.0 19 37.29225 38.0 38.0 38.0 37.0 38.0 20 37.295 38.0 38.0 38.0 37.0 38.0 21 37.262 38.0 38.0 38.0 37.0 38.0 22 37.24175 38.0 38.0 38.0 37.0 38.0 23 37.272 38.0 38.0 38.0 37.0 38.0 24 37.259 38.0 38.0 38.0 37.0 38.0 25 37.165 38.0 38.0 38.0 37.0 38.0 26 37.18575 38.0 38.0 38.0 37.0 38.0 27 37.22275 38.0 38.0 38.0 37.0 38.0 28 37.11475 38.0 38.0 38.0 36.0 38.0 29 37.198 38.0 38.0 38.0 37.0 38.0 30 37.05575 38.0 38.0 38.0 36.0 38.0 31 37.1 38.0 38.0 38.0 36.0 38.0 32 37.1045 38.0 38.0 38.0 36.0 38.0 33 37.114 38.0 38.0 38.0 36.0 38.0 34 37.13325 38.0 38.0 38.0 36.0 38.0 35 37.19175 38.0 38.0 38.0 37.0 38.0 36 37.08675 38.0 38.0 38.0 36.0 38.0 37 37.0355 38.0 38.0 38.0 36.0 38.0 38 37.0825 38.0 38.0 38.0 37.0 38.0 39 37.118 38.0 38.0 38.0 37.0 38.0 40 36.992 38.0 38.0 38.0 36.0 38.0 41 37.0845 38.0 38.0 38.0 36.0 38.0 42 37.0755 38.0 38.0 38.0 36.0 38.0 43 37.034 38.0 38.0 38.0 36.0 38.0 44 37.065 38.0 38.0 38.0 37.0 38.0 45 37.03975 38.0 38.0 38.0 37.0 38.0 46 37.0045 38.0 38.0 38.0 36.0 38.0 47 37.064 38.0 38.0 38.0 36.0 38.0 48 37.05225 38.0 38.0 38.0 36.0 38.0 49 37.15875 38.0 38.0 38.0 37.0 38.0 50 37.127 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 0.0 24 2.0 25 5.0 26 12.0 27 17.0 28 21.0 29 28.0 30 25.0 31 50.0 32 63.0 33 93.0 34 104.0 35 202.0 36 716.0 37 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.35360556038228 11.178685201274256 9.06458152331306 36.40312771503041 2 25.95 10.8 32.125 31.125000000000004 3 22.6 14.025000000000002 22.45 40.925 4 27.450000000000003 19.025 21.45 32.074999999999996 5 27.875 22.900000000000002 23.95 25.275 6 25.825 27.625 23.400000000000002 23.150000000000002 7 18.975 25.624999999999996 35.975 19.425 8 22.15 25.2 28.4 24.25 9 22.1 21.15 32.75 24.0 10 21.5 31.624999999999996 26.200000000000003 20.674999999999997 11 25.95 24.925 23.025000000000002 26.1 12 24.575 20.9 26.650000000000002 27.875 13 23.674999999999997 23.825 27.1 25.4 14 24.25 23.1 25.974999999999998 26.674999999999997 15 23.9 23.625 25.4 27.075 16 25.025 24.15 24.55 26.275 17 24.875 24.425 25.4 25.3 18 24.8 23.325000000000003 25.324999999999996 26.55 19 25.900000000000002 23.375 23.799999999999997 26.924999999999997 20 24.275 25.45 25.224999999999998 25.05 21 24.325 24.15 25.174999999999997 26.35 22 24.4 25.25 23.65 26.700000000000003 23 23.925 24.775 26.5 24.8 24 23.925 23.5 24.325 28.249999999999996 25 24.95 24.025 23.75 27.275 26 24.2 25.35 24.6 25.85 27 23.375 24.15 25.124999999999996 27.35 28 24.3 24.8 24.325 26.575 29 25.0 25.074999999999996 25.35 24.575 30 24.25 24.0 24.725 27.025 31 24.275 23.825 24.025 27.875 32 24.175 25.0 25.074999999999996 25.75 33 24.375 24.099999999999998 25.174999999999997 26.35 34 26.224999999999998 23.775 24.75 25.25 35 23.775 25.15 24.575 26.5 36 25.0 24.575 24.2 26.224999999999998 37 23.625 24.2 23.925 28.249999999999996 38 23.599999999999998 23.674999999999997 26.474999999999998 26.25 39 25.3 24.625 24.2 25.874999999999996 40 25.374999999999996 24.7 23.724999999999998 26.200000000000003 41 25.45 23.875 24.3 26.375 42 24.925 23.599999999999998 24.925 26.55 43 24.45 24.6 24.2 26.75 44 24.2 23.674999999999997 24.8 27.325 45 25.275 23.150000000000002 24.85 26.724999999999998 46 24.575 24.9 24.224999999999998 26.3 47 24.875 24.4 24.375 26.35 48 24.675 23.5 25.974999999999998 25.85 49 24.8 24.025 25.374999999999996 25.8 50 23.775 24.95 25.15 26.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 4.0 25 5.5 26 7.0 27 7.5 28 8.0 29 19.0 30 30.0 31 38.5 32 47.0 33 59.0 34 71.0 35 84.0 36 97.0 37 125.5 38 154.0 39 181.5 40 209.0 41 242.0 42 275.0 43 273.5 44 272.0 45 302.5 46 333.0 47 322.5 48 312.0 49 306.5 50 301.0 51 282.0 52 263.0 53 255.0 54 247.0 55 235.5 56 224.0 57 214.5 58 205.0 59 187.5 60 170.0 61 167.5 62 165.0 63 160.0 64 155.0 65 136.5 66 118.0 67 112.0 68 106.0 69 93.5 70 81.0 71 73.5 72 66.0 73 50.0 74 34.0 75 24.0 76 14.0 77 12.0 78 10.0 79 10.0 80 10.0 81 7.5 82 5.0 83 4.0 84 3.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52153110047847 98.8 2 0.45328632586250317 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02518257365902795 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 12 0.3 TruSeq Adapter, Index 10 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104601 spots for SRR6322388.sra Written 1104601 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra Read 1104599 spots for SRR6322388.sra Written 1104599 spots for SRR6322388.sra SRR ids: ['SRR6322388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7j280vpg SRR6322388.sra spots: 22091982 blocks: [[1, 1104599], [1104600, 2209198], [2209199, 3313797], [3313798, 4418396], [4418397, 5522995], [5522996, 6627594], [6627595, 7732193], [7732194, 8836792], [8836793, 9941391], [9941392, 11045990], [11045991, 12150589], [12150590, 13255188], [13255189, 14359787], [14359788, 15464386], [15464387, 16568985], [16568986, 17673584], [17673585, 18778183], [18778184, 19882782], [19882783, 20987381], [20987382, 22091982]] SRR6322388 file size 3839808 SRR6322388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322388 SRR6322388_1.fastq Input file: SRR6322388_1.fastq trimmed: SRR6322388-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:53:36 2024 >> started Sat Dec 7 11:53:51 2024 >> done (15.097s) 22091982 reads processed; of these: 4897 ( 0.02%) short reads filtered out after trimming by size control 68394 ( 0.31%) empty reads filtered out after trimming by size control 22018691 (99.67%) reads available; of these: 185914 ( 0.84%) trimmed reads available after processing 21832777 (99.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 241 0.00% 19 287 0.00% 20 328 0.00% 21 371 0.00% 22 433 0.00% 23 610 0.00% 24 3383 0.02% 25 2663 0.01% 26 1838 0.01% 27 1309 0.01% 28 801 0.00% 29 908 0.00% 30 1055 0.00% 31 988 0.00% 32 992 0.00% 33 1066 0.00% 34 1164 0.01% 35 1277 0.01% 36 1511 0.01% 37 1777 0.01% 38 2084 0.01% 39 2436 0.01% 40 2986 0.01% 41 3716 0.02% 42 4977 0.02% 43 6403 0.03% 44 8467 0.04% 45 11027 0.05% 46 15332 0.07% 47 21596 0.10% 48 34156 0.16% 49 49732 0.23% 50 21832777 99.16% 22018691 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.12 prefix-fanout=1.9 sequence=CCTGCAGTTGTCGCAGCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=10.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.8 sequence=ATGTCGGCGTCAGGCTTGTCCTTGAGGATCACCTTCTTTGCCTCCTTGATGGACAGCCCGACCACCTCCGGCCACGACTTCGTCACCTCGC Started job on | Dec 07 11:54:02 Started mapping on | Dec 07 11:54:02 Finished on | Dec 07 11:54:22 Mapping speed, Million of reads per hour | 3963.36 Number of input reads | 22018691 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20907034 Uniquely mapped reads % | 94.95% Average mapped length | 49.74 Number of splices: Total | 2973265 Number of splices: Annotated (sjdb) | 2862779 Number of splices: GT/AG | 2937832 Number of splices: GC/AG | 29270 Number of splices: AT/AC | 1604 Number of splices: Non-canonical | 4559 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 575166 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 409846 % of reads mapped to too many loci | 1.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 536491 536491 536491 N_multimapping 575166 575166 575166 N_noFeature 836729 20452279 976536 N_ambiguous 337373 1080 23153 UnstrandedReadsAssigned:19732932 PositiveStrandReadsAssigned:453675 NegativeStrandReadsAssigned:19907345 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322388 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322388-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,018,691 reads, 19,832,515 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR6322388.ke.tsv 35125 SRR6322388.se.tsv 88098 total ==> SRR6322388.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.000599644 5.84424e-05 PNS24247 1044 945 120.793 10.4273 PNS24249 1928 1829 47.0622 2.09903 PNS24246 1044 945 120.793 10.4273 PNS24248 1044 945 120.793 10.4273 PNS24244 1471 1372 146.557 8.7139 PNS24243 293 194 0 0 KQK14069 1603 1504 5934.91 321.904 KQK14071 474 375 2484.89 540.549 ==> SRR6322388.se.tsv <== BRADI_1g14170v3 9205 BRADI_1g53295v3 235 BRADI_1g59795v3 319 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 2170 BRADI_1g74790v3 592 BRADI_1g09890v3 1 BRADI_1g77505v3 177 BRADI_1g48960v3 0 SRR6322388 completed mapping pipeline successfully