Starting /dee2/code/volunteer_pipeline.sh SRR6322389 current disk space = 1516002861056 free memory = 1601313304 SRR6322389 SRAfilesize 0e94c481d3bc79bb8665df6377af0473 SRR6322389.sra SRR6322389.sra file validated SRR6322389 is single end SRR6322389 is conventional basespace SRR6322389 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.96025 33.0 32.0 34.0 2.0 34.0 2 32.07025 34.0 32.0 34.0 27.0 34.0 3 32.371 34.0 32.0 34.0 27.0 34.0 4 32.759 34.0 33.0 34.0 32.0 34.0 5 32.87 34.0 33.0 34.0 32.0 34.0 6 36.78125 38.0 37.0 38.0 34.0 38.0 7 37.15875 38.0 38.0 38.0 36.0 38.0 8 37.24675 38.0 38.0 38.0 37.0 38.0 9 37.3425 38.0 38.0 38.0 37.0 38.0 10 37.3255 38.0 38.0 38.0 37.0 38.0 11 37.30475 38.0 38.0 38.0 37.0 38.0 12 37.34075 38.0 38.0 38.0 37.0 38.0 13 37.34575 38.0 38.0 38.0 37.0 38.0 14 37.35975 38.0 38.0 38.0 37.0 38.0 15 37.29325 38.0 38.0 38.0 37.0 38.0 16 37.31675 38.0 38.0 38.0 37.0 38.0 17 37.34 38.0 38.0 38.0 37.0 38.0 18 37.3345 38.0 38.0 38.0 37.0 38.0 19 37.29625 38.0 38.0 38.0 37.0 38.0 20 37.2615 38.0 38.0 38.0 37.0 38.0 21 37.26775 38.0 38.0 38.0 37.0 38.0 22 37.2795 38.0 38.0 38.0 37.0 38.0 23 37.27325 38.0 38.0 38.0 37.0 38.0 24 37.30125 38.0 38.0 38.0 37.0 38.0 25 37.24925 38.0 38.0 38.0 37.0 38.0 26 37.24 38.0 38.0 38.0 37.0 38.0 27 37.1515 38.0 38.0 38.0 37.0 38.0 28 37.11375 38.0 38.0 38.0 37.0 38.0 29 37.13975 38.0 38.0 38.0 37.0 38.0 30 37.0275 38.0 38.0 38.0 36.0 38.0 31 37.14525 38.0 38.0 38.0 36.0 38.0 32 37.0765 38.0 38.0 38.0 36.0 38.0 33 37.1035 38.0 38.0 38.0 37.0 38.0 34 37.09425 38.0 38.0 38.0 37.0 38.0 35 37.077 38.0 38.0 38.0 36.0 38.0 36 37.1445 38.0 38.0 38.0 36.0 38.0 37 37.03075 38.0 38.0 38.0 36.0 38.0 38 37.11575 38.0 38.0 38.0 36.0 38.0 39 37.15525 38.0 38.0 38.0 37.0 38.0 40 37.01425 38.0 38.0 38.0 36.0 38.0 41 37.0745 38.0 38.0 38.0 36.0 38.0 42 37.20475 38.0 38.0 38.0 37.0 38.0 43 37.00325 38.0 38.0 38.0 36.0 38.0 44 37.08275 38.0 38.0 38.0 36.0 38.0 45 37.105 38.0 38.0 38.0 36.0 38.0 46 37.01475 38.0 38.0 38.0 36.0 38.0 47 36.9965 38.0 38.0 38.0 36.0 38.0 48 37.026 38.0 38.0 38.0 36.0 38.0 49 37.0745 38.0 38.0 38.0 36.0 38.0 50 37.02425 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 0.0 20 0.0 21 0.0 22 1.0 23 6.0 24 1.0 25 7.0 26 11.0 27 17.0 28 24.0 29 30.0 30 33.0 31 46.0 32 50.0 33 72.0 34 117.0 35 184.0 36 843.0 37 2554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.01521025946913 9.126155681479272 6.620936474798687 51.237697584252906 2 21.349999999999998 11.95 38.925 27.775 3 21.425 14.7 24.825 39.050000000000004 4 26.924999999999997 21.525 21.0 30.55 5 27.474999999999998 26.424999999999997 23.275000000000002 22.825 6 23.275000000000002 31.574999999999996 23.05 22.1 7 19.1 24.099999999999998 38.05 18.75 8 20.125 24.05 30.875000000000004 24.95 9 20.025000000000002 22.325 34.375 23.275000000000002 10 20.674999999999997 32.975 26.450000000000003 19.900000000000002 11 26.200000000000003 25.124999999999996 24.075 24.6 12 22.55 22.5 26.200000000000003 28.749999999999996 13 22.6 25.174999999999997 27.025 25.2 14 22.275 25.275 27.175 25.275 15 23.175 25.424999999999997 26.724999999999998 24.675 16 24.425 25.6 23.75 26.224999999999998 17 23.45 26.075 26.174999999999997 24.3 18 22.825 25.174999999999997 25.974999999999998 26.025 19 23.974999999999998 24.9 25.424999999999997 25.7 20 23.575 25.924999999999997 25.1 25.4 21 24.05 25.3 25.55 25.1 22 22.95 26.325 25.3 25.424999999999997 23 21.95 27.3 25.7 25.05 24 21.55 24.375 25.775 28.299999999999997 25 23.35 24.775 26.325 25.55 26 22.25 27.575 25.324999999999996 24.85 27 22.225 25.224999999999998 25.775 26.775 28 23.05 25.0 26.075 25.874999999999996 29 23.9 24.55 26.775 24.775 30 23.5 23.849999999999998 25.775 26.875 31 23.599999999999998 23.724999999999998 27.224999999999998 25.45 32 23.25 24.8 25.624999999999996 26.325 33 21.7 26.1 25.324999999999996 26.875 34 24.075 26.75 23.599999999999998 25.575 35 23.025000000000002 25.15 27.325 24.5 36 23.1 23.974999999999998 26.724999999999998 26.200000000000003 37 23.75 25.35 25.624999999999996 25.275 38 23.325000000000003 25.674999999999997 25.874999999999996 25.124999999999996 39 22.375 26.325 25.974999999999998 25.324999999999996 40 23.25 26.1 24.95 25.7 41 23.25 26.075 26.150000000000002 24.525 42 22.95 24.9 25.275 26.875 43 23.275000000000002 24.875 26.075 25.775 44 21.725 26.025 25.650000000000002 26.6 45 22.35 25.624999999999996 25.650000000000002 26.375 46 22.55 26.125 26.650000000000002 24.675 47 23.0 26.474999999999998 25.6 24.925 48 22.6 24.6 25.8 27.0 49 22.925 25.424999999999997 24.725 26.924999999999997 50 23.825 25.624999999999996 25.7 24.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 2.0 19 1.5 20 1.0 21 1.5 22 2.0 23 4.5 24 7.0 25 9.5 26 12.0 27 16.0 28 20.0 29 27.5 30 35.0 31 52.0 32 69.0 33 78.0 34 87.0 35 120.0 36 153.0 37 168.0 38 183.0 39 239.5 40 296.0 41 301.0 42 306.0 43 308.0 44 310.0 45 319.0 46 328.0 47 309.5 48 291.0 49 296.0 50 301.0 51 292.5 52 284.0 53 277.5 54 271.0 55 230.0 56 189.0 57 182.0 58 175.0 59 174.5 60 174.0 61 152.5 62 131.0 63 120.0 64 109.0 65 91.5 66 74.0 67 62.5 68 51.0 69 52.5 70 54.0 71 48.5 72 43.0 73 30.0 74 17.0 75 16.0 76 15.0 77 10.0 78 5.0 79 4.5 80 4.0 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36948297604036 98.5 2 0.5548549810844893 1.0999999999999999 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025220680958385876 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC 10 0.25 TruSeq Adapter, Index 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277299 spots for SRR6322389.sra Written 1277299 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra Read 1277291 spots for SRR6322389.sra Written 1277291 spots for SRR6322389.sra SRR ids: ['SRR6322389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wfb1lf68 SRR6322389.sra spots: 25545828 blocks: [[1, 1277291], [1277292, 2554582], [2554583, 3831873], [3831874, 5109164], [5109165, 6386455], [6386456, 7663746], [7663747, 8941037], [8941038, 10218328], [10218329, 11495619], [11495620, 12772910], [12772911, 14050201], [14050202, 15327492], [15327493, 16604783], [16604784, 17882074], [17882075, 19159365], [19159366, 20436656], [20436657, 21713947], [21713948, 22991238], [22991239, 24268529], [24268530, 25545828]] SRR6322389 file size 4441817 SRR6322389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322389 SRR6322389_1.fastq Input file: SRR6322389_1.fastq trimmed: SRR6322389-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Dec 12 02:24:54 2024 >> started Thu Dec 12 02:25:13 2024 >> done (18.707s) 25545828 reads processed; of these: 5954 ( 0.02%) short reads filtered out after trimming by size control 95330 ( 0.37%) empty reads filtered out after trimming by size control 25444544 (99.60%) reads available; of these: 191368 ( 0.75%) trimmed reads available after processing 25253176 (99.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 280 0.00% 19 302 0.00% 20 335 0.00% 21 362 0.00% 22 444 0.00% 23 608 0.00% 24 3762 0.01% 25 2943 0.01% 26 1946 0.01% 27 1444 0.01% 28 843 0.00% 29 873 0.00% 30 1031 0.00% 31 987 0.00% 32 997 0.00% 33 1163 0.00% 34 1191 0.00% 35 1377 0.01% 36 1601 0.01% 37 1826 0.01% 38 2139 0.01% 39 2603 0.01% 40 3128 0.01% 41 4066 0.02% 42 5029 0.02% 43 6824 0.03% 44 8829 0.03% 45 11733 0.05% 46 16117 0.06% 47 22442 0.09% 48 34546 0.14% 49 49597 0.19% 50 25253176 99.25% 25444544 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=19 prefix-density=0.34 prefix-fanout=1.9 sequence=GGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=104.19 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.2 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 12 02:25:24 Started mapping on | Dec 12 02:25:24 Finished on | Dec 12 02:25:44 Mapping speed, Million of reads per hour | 4580.02 Number of input reads | 25444544 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 24119386 Uniquely mapped reads % | 94.79% Average mapped length | 49.77 Number of splices: Total | 3614546 Number of splices: Annotated (sjdb) | 3468331 Number of splices: GT/AG | 3570569 Number of splices: GC/AG | 35912 Number of splices: AT/AC | 2228 Number of splices: Non-canonical | 5837 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 585127 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 599147 % of reads mapped to too many loci | 2.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 740031 740031 740031 N_multimapping 585127 585127 585127 N_noFeature 1354838 23395614 1524302 N_ambiguous 613141 1476 60130 UnstrandedReadsAssigned:22151407 PositiveStrandReadsAssigned:722296 NegativeStrandReadsAssigned:22534954 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322389 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322389-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,444,544 reads, 22,392,140 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52973 SRR6322389.ke.tsv 35125 SRR6322389.se.tsv 88098 total ==> SRR6322389.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 74.1839 6.15788 PNS24249 1928 1829 0 0 PNS24246 1044 945 74.1839 6.15788 PNS24248 1044 945 74.1839 6.15788 PNS24244 1471 1372 93.4482 5.34281 PNS24243 293 194 0 0 KQK14069 1603 1504 3976.06 207.376 KQK14071 474 375 1239 259.176 ==> SRR6322389.se.tsv <== BRADI_1g14170v3 5774 BRADI_1g53295v3 171 BRADI_1g59795v3 491 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 10013 BRADI_1g74790v3 41 BRADI_1g09890v3 0 BRADI_1g77505v3 313 BRADI_1g48960v3 0 SRR6322389 completed mapping pipeline successfully