Starting /dee2/code/volunteer_pipeline.sh SRR6322390 current disk space = 1543828758528 free memory = 1605761956 SRR6322390 SRAfilesize d65bc725baa41d6cc2a385e5b7dfed04 SRR6322390.sra SRR6322390.sra file validated SRR6322390 is single end SRR6322390 is conventional basespace SRR6322390 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.64175 33.0 32.0 34.0 2.0 34.0 2 31.86375 33.0 32.0 34.0 27.0 34.0 3 32.1905 34.0 32.0 34.0 27.0 34.0 4 32.704 34.0 33.0 34.0 32.0 34.0 5 32.73825 34.0 33.0 34.0 32.0 34.0 6 36.64525 38.0 37.0 38.0 34.0 38.0 7 37.08 38.0 38.0 38.0 36.0 38.0 8 37.235 38.0 38.0 38.0 37.0 38.0 9 37.27775 38.0 38.0 38.0 37.0 38.0 10 37.353 38.0 38.0 38.0 37.0 38.0 11 37.3235 38.0 38.0 38.0 37.0 38.0 12 37.28275 38.0 38.0 38.0 37.0 38.0 13 37.20425 38.0 38.0 38.0 37.0 38.0 14 37.259 38.0 38.0 38.0 37.0 38.0 15 37.29775 38.0 38.0 38.0 37.0 38.0 16 37.209 38.0 38.0 38.0 37.0 38.0 17 37.31975 38.0 38.0 38.0 37.0 38.0 18 37.3045 38.0 38.0 38.0 37.0 38.0 19 37.30225 38.0 38.0 38.0 37.0 38.0 20 37.30675 38.0 38.0 38.0 37.0 38.0 21 37.2485 38.0 38.0 38.0 37.0 38.0 22 37.2975 38.0 38.0 38.0 37.0 38.0 23 37.21275 38.0 38.0 38.0 37.0 38.0 24 37.205 38.0 38.0 38.0 37.0 38.0 25 37.239 38.0 38.0 38.0 37.0 38.0 26 37.1795 38.0 38.0 38.0 37.0 38.0 27 37.1945 38.0 38.0 38.0 37.0 38.0 28 37.18175 38.0 38.0 38.0 37.0 38.0 29 37.1635 38.0 38.0 38.0 37.0 38.0 30 37.098 38.0 38.0 38.0 36.0 38.0 31 37.17475 38.0 38.0 38.0 37.0 38.0 32 37.1485 38.0 38.0 38.0 37.0 38.0 33 37.1275 38.0 38.0 38.0 36.0 38.0 34 37.1585 38.0 38.0 38.0 37.0 38.0 35 37.21325 38.0 38.0 38.0 37.0 38.0 36 37.1735 38.0 38.0 38.0 37.0 38.0 37 37.02375 38.0 38.0 38.0 36.0 38.0 38 37.166 38.0 38.0 38.0 37.0 38.0 39 37.1255 38.0 38.0 38.0 37.0 38.0 40 36.9965 38.0 38.0 38.0 36.0 38.0 41 37.0925 38.0 38.0 38.0 36.0 38.0 42 37.17775 38.0 38.0 38.0 37.0 38.0 43 37.0025 38.0 38.0 38.0 36.0 38.0 44 37.1015 38.0 38.0 38.0 36.0 38.0 45 37.075 38.0 38.0 38.0 36.0 38.0 46 37.1395 38.0 38.0 38.0 37.0 38.0 47 37.00975 38.0 38.0 38.0 36.0 38.0 48 37.0075 38.0 38.0 38.0 36.0 38.0 49 36.9925 38.0 38.0 38.0 36.0 38.0 50 37.0415 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 5.0 23 5.0 24 1.0 25 3.0 26 9.0 27 9.0 28 25.0 29 30.0 30 35.0 31 44.0 32 66.0 33 78.0 34 110.0 35 190.0 36 845.0 37 2539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.80728696175851 10.057211683227942 7.317073170731707 42.81842818428184 2 23.125 11.825 37.05 28.000000000000004 3 21.375 14.35 25.2 39.074999999999996 4 26.450000000000003 21.55 22.3 29.7 5 27.250000000000004 27.625 23.599999999999998 21.525 6 25.374999999999996 28.775000000000002 23.3 22.55 7 18.8 24.625 37.05 19.525000000000002 8 19.875 24.875 31.075000000000003 24.175 9 22.0 20.724999999999998 31.900000000000002 25.374999999999996 10 21.15 35.625 24.25 18.975 11 26.575 24.85 22.825 25.75 12 23.200000000000003 23.25 26.0 27.55 13 23.45 24.9 26.1 25.55 14 22.325 24.825 26.775 26.075 15 23.425 23.875 26.5 26.200000000000003 16 24.349999999999998 25.724999999999998 24.9 25.025 17 24.4 25.35 24.075 26.174999999999997 18 24.349999999999998 24.099999999999998 25.374999999999996 26.174999999999997 19 24.224999999999998 24.75 25.5 25.525 20 23.599999999999998 26.35 25.124999999999996 24.925 21 24.7 25.650000000000002 24.275 25.374999999999996 22 23.325000000000003 26.125 25.55 25.0 23 23.225 26.025 25.0 25.75 24 23.674999999999997 24.725 25.525 26.075 25 24.175 25.1 25.324999999999996 25.4 26 23.325000000000003 25.374999999999996 25.674999999999997 25.624999999999996 27 23.849999999999998 25.575 24.25 26.325 28 23.599999999999998 25.174999999999997 26.125 25.1 29 24.025 24.975 26.150000000000002 24.85 30 24.5 24.7 25.2 25.6 31 24.15 24.375 24.675 26.8 32 24.2 25.45 25.25 25.1 33 22.625 24.725 25.8 26.85 34 24.25 23.875 26.325 25.55 35 23.799999999999997 25.3 26.450000000000003 24.45 36 23.775 25.7 24.65 25.874999999999996 37 24.7 24.825 23.95 26.525 38 24.224999999999998 25.674999999999997 24.175 25.924999999999997 39 22.525000000000002 25.4 25.374999999999996 26.700000000000003 40 22.925 25.7 24.625 26.75 41 23.474999999999998 25.775 25.35 25.4 42 23.225 25.85 25.5 25.424999999999997 43 24.275 24.474999999999998 25.0 26.25 44 24.175 25.05 25.874999999999996 24.9 45 23.799999999999997 24.625 25.474999999999998 26.1 46 24.099999999999998 24.525 24.7 26.674999999999997 47 23.3 26.25 25.124999999999996 25.324999999999996 48 23.375 24.65 26.3 25.674999999999997 49 25.3 25.624999999999996 24.325 24.75 50 24.275 25.4 24.25 26.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 4.0 25 6.0 26 8.0 27 11.0 28 14.0 29 32.0 30 50.0 31 57.0 32 64.0 33 76.5 34 89.0 35 119.0 36 149.0 37 166.5 38 184.0 39 200.0 40 216.0 41 265.0 42 314.0 43 316.5 44 319.0 45 326.5 46 334.0 47 313.5 48 293.0 49 300.0 50 307.0 51 292.5 52 278.0 53 247.0 54 216.0 55 214.5 56 213.0 57 186.0 58 159.0 59 165.5 60 172.0 61 155.5 62 139.0 63 131.5 64 124.0 65 120.0 66 116.0 67 91.5 68 67.0 69 56.5 70 46.0 71 43.5 72 41.0 73 40.0 74 39.0 75 26.5 76 14.0 77 13.5 78 13.0 79 11.0 80 9.0 81 6.5 82 4.0 83 2.5 84 1.0 85 1.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36852740591058 98.35000000000001 2 0.5051780752715332 1.0 3 0.07577671129072998 0.22499999999999998 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 13 0.325 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424223 spots for SRR6322390.sra Written 1424223 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra Read 1424215 spots for SRR6322390.sra Written 1424215 spots for SRR6322390.sra SRR ids: ['SRR6322390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yrpsoa8d SRR6322390.sra spots: 28484308 blocks: [[1, 1424215], [1424216, 2848430], [2848431, 4272645], [4272646, 5696860], [5696861, 7121075], [7121076, 8545290], [8545291, 9969505], [9969506, 11393720], [11393721, 12817935], [12817936, 14242150], [14242151, 15666365], [15666366, 17090580], [17090581, 18514795], [18514796, 19939010], [19939011, 21363225], [21363226, 22787440], [22787441, 24211655], [24211656, 25635870], [25635871, 27060085], [27060086, 28484308]] SRR6322390 file size 4953989 SRR6322390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322390 SRR6322390_1.fastq Input file: SRR6322390_1.fastq trimmed: SRR6322390-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:14:36 2024 >> started Sat Dec 7 10:14:53 2024 >> done (17.541s) 28484308 reads processed; of these: 6187 ( 0.02%) short reads filtered out after trimming by size control 151688 ( 0.53%) empty reads filtered out after trimming by size control 28326433 (99.45%) reads available; of these: 232395 ( 0.82%) trimmed reads available after processing 28094038 (99.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 334 0.00% 19 371 0.00% 20 388 0.00% 21 470 0.00% 22 572 0.00% 23 826 0.00% 24 4297 0.02% 25 3359 0.01% 26 2398 0.01% 27 1645 0.01% 28 1044 0.00% 29 1153 0.00% 30 1295 0.00% 31 1209 0.00% 32 1327 0.00% 33 1437 0.01% 34 1599 0.01% 35 1650 0.01% 36 1892 0.01% 37 2191 0.01% 38 2645 0.01% 39 3207 0.01% 40 3803 0.01% 41 4876 0.02% 42 6164 0.02% 43 8135 0.03% 44 10536 0.04% 45 13980 0.05% 46 19253 0.07% 47 27003 0.10% 48 42247 0.15% 49 61089 0.22% 50 28094038 99.18% 28326433 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.1 sequence=GTTTCTGATCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=97.13 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.5 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 10:15:04 Started mapping on | Dec 07 10:15:05 Finished on | Dec 07 10:15:25 Mapping speed, Million of reads per hour | 5098.76 Number of input reads | 28326433 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27174991 Uniquely mapped reads % | 95.94% Average mapped length | 49.76 Number of splices: Total | 4030690 Number of splices: Annotated (sjdb) | 3875720 Number of splices: GT/AG | 3983246 Number of splices: GC/AG | 38958 Number of splices: AT/AC | 2337 Number of splices: Non-canonical | 6149 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 604152 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 400939 % of reads mapped to too many loci | 1.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547290 547290 547290 N_multimapping 604152 604152 604152 N_noFeature 1252056 26404014 1422487 N_ambiguous 649570 1576 51000 UnstrandedReadsAssigned:25273365 PositiveStrandReadsAssigned:769401 NegativeStrandReadsAssigned:25701504 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322390 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322390-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,326,433 reads, 25,519,880 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52973 SRR6322390.ke.tsv 35125 SRR6322390.se.tsv 88098 total ==> SRR6322390.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 3.16359e-07 2.51046e-08 PNS24247 1044 945 54.9524 3.86236 PNS24249 1928 1829 16.0088 0.581355 PNS24246 1044 945 54.9524 3.86236 PNS24248 1044 945 54.9524 3.86236 PNS24244 1471 1372 121.134 5.86421 PNS24243 293 194 1 0.34237 KQK14069 1603 1504 7663.28 338.427 KQK14071 474 375 3347.63 592.931 ==> SRR6322390.se.tsv <== BRADI_1g14170v3 11599 BRADI_1g53295v3 182 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 12660 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 269 BRADI_1g48960v3 0 SRR6322390 completed mapping pipeline successfully