Starting /dee2/code/volunteer_pipeline.sh SRR6322391 current disk space = 1543804174336 free memory = 1605808168 SRR6322391 SRAfilesize 33f26c6baa57126b0bf75933e898004c SRR6322391.sra SRR6322391.sra file validated SRR6322391 is single end SRR6322391 is conventional basespace SRR6322391 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.689 33.0 32.0 34.0 2.0 34.0 2 32.05575 34.0 32.0 34.0 27.0 34.0 3 32.36 34.0 32.0 34.0 28.0 34.0 4 32.64225 34.0 33.0 34.0 32.0 34.0 5 32.872 34.0 33.0 34.0 32.0 34.0 6 36.783 38.0 37.0 38.0 35.0 38.0 7 36.99775 38.0 38.0 38.0 36.0 38.0 8 37.21075 38.0 38.0 38.0 36.0 38.0 9 37.242 38.0 38.0 38.0 37.0 38.0 10 37.22125 38.0 38.0 38.0 37.0 38.0 11 37.28925 38.0 38.0 38.0 37.0 38.0 12 37.2105 38.0 38.0 38.0 37.0 38.0 13 37.28175 38.0 38.0 38.0 37.0 38.0 14 37.21275 38.0 38.0 38.0 37.0 38.0 15 37.253 38.0 38.0 38.0 37.0 38.0 16 37.1905 38.0 38.0 38.0 37.0 38.0 17 37.21425 38.0 38.0 38.0 37.0 38.0 18 37.18425 38.0 38.0 38.0 37.0 38.0 19 37.278 38.0 38.0 38.0 37.0 38.0 20 37.179 38.0 38.0 38.0 37.0 38.0 21 37.2655 38.0 38.0 38.0 37.0 38.0 22 37.246 38.0 38.0 38.0 37.0 38.0 23 37.22125 38.0 38.0 38.0 37.0 38.0 24 37.17375 38.0 38.0 38.0 37.0 38.0 25 37.09825 38.0 38.0 38.0 37.0 38.0 26 37.07475 38.0 38.0 38.0 37.0 38.0 27 37.112 38.0 38.0 38.0 37.0 38.0 28 37.10675 38.0 38.0 38.0 36.0 38.0 29 37.09825 38.0 38.0 38.0 37.0 38.0 30 36.9915 38.0 38.0 38.0 37.0 38.0 31 37.1085 38.0 38.0 38.0 37.0 38.0 32 36.94175 38.0 38.0 38.0 36.0 38.0 33 36.9975 38.0 38.0 38.0 36.0 38.0 34 37.02475 38.0 38.0 38.0 36.0 38.0 35 37.0635 38.0 38.0 38.0 36.0 38.0 36 36.99775 38.0 38.0 38.0 36.0 38.0 37 36.9175 38.0 38.0 38.0 36.0 38.0 38 36.99225 38.0 38.0 38.0 36.0 38.0 39 37.03675 38.0 38.0 38.0 36.0 38.0 40 36.95 38.0 38.0 38.0 36.0 38.0 41 37.056 38.0 38.0 38.0 36.0 38.0 42 37.1065 38.0 38.0 38.0 36.0 38.0 43 37.05 38.0 38.0 38.0 36.0 38.0 44 37.04875 38.0 38.0 38.0 36.0 38.0 45 37.02 38.0 38.0 38.0 36.0 38.0 46 37.01375 38.0 38.0 38.0 37.0 38.0 47 37.01525 38.0 38.0 38.0 36.0 38.0 48 36.97225 38.0 38.0 38.0 36.0 38.0 49 36.95775 38.0 38.0 38.0 36.0 38.0 50 36.9515 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 3.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 1.0 24 4.0 25 6.0 26 7.0 27 12.0 28 24.0 29 31.0 30 36.0 31 46.0 32 56.0 33 67.0 34 111.0 35 177.0 36 748.0 37 2653.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0462962962963 9.25925925925926 6.944444444444445 43.75 2 21.6 12.55 38.175 27.675 3 21.525 14.575 25.374999999999996 38.525 4 26.775 23.400000000000002 22.375 27.450000000000003 5 27.375 27.35 24.075 21.2 6 21.5 31.574999999999996 23.525 23.400000000000002 7 18.05 22.5 39.675 19.775000000000002 8 19.400000000000002 23.875 30.025000000000002 26.700000000000003 9 20.599999999999998 21.15 33.324999999999996 24.925 10 20.549999999999997 34.55 24.75 20.150000000000002 11 26.200000000000003 24.875 22.525000000000002 26.400000000000002 12 23.425 22.825 25.650000000000002 28.1 13 23.075000000000003 24.725 27.275 24.925 14 21.975 25.900000000000002 25.924999999999997 26.200000000000003 15 24.025 24.375 26.125 25.474999999999998 16 24.85 24.275 23.775 27.1 17 24.725 24.85 25.55 24.875 18 23.575 24.175 26.3 25.95 19 24.349999999999998 24.975 24.725 25.95 20 22.75 25.85 25.95 25.45 21 24.5 24.825 25.0 25.674999999999997 22 23.549999999999997 26.75 24.15 25.55 23 23.95 25.900000000000002 25.7 24.45 24 22.8 24.4 25.05 27.750000000000004 25 24.05 24.349999999999998 25.124999999999996 26.474999999999998 26 22.3 25.525 26.0 26.174999999999997 27 22.6 25.874999999999996 24.65 26.875 28 23.849999999999998 25.374999999999996 25.724999999999998 25.05 29 24.525 24.95 25.825 24.7 30 23.075000000000003 23.875 26.174999999999997 26.875 31 23.9 26.375 23.575 26.150000000000002 32 23.5 26.0 25.624999999999996 24.875 33 23.724999999999998 23.775 25.074999999999996 27.425 34 24.4 25.674999999999997 24.85 25.074999999999996 35 23.1 25.074999999999996 26.200000000000003 25.624999999999996 36 24.625 24.725 24.7 25.95 37 23.525 24.55 25.5 26.424999999999997 38 23.7 25.05 26.3 24.95 39 23.599999999999998 23.474999999999998 25.75 27.175 40 24.175 25.6 24.25 25.974999999999998 41 24.025 24.275 26.650000000000002 25.05 42 23.7 24.975 24.725 26.6 43 23.825 25.124999999999996 25.624999999999996 25.424999999999997 44 23.400000000000002 25.6 25.2 25.8 45 23.125 25.275 24.4 27.200000000000003 46 22.5 25.224999999999998 25.8 26.474999999999998 47 24.725 24.15 26.075 25.05 48 24.8 24.875 24.925 25.4 49 23.575 25.224999999999998 25.174999999999997 26.025 50 22.825 24.85 26.25 26.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 3.0 24 6.0 25 10.5 26 15.0 27 14.5 28 14.0 29 22.0 30 30.0 31 45.0 32 60.0 33 75.0 34 90.0 35 114.5 36 139.0 37 171.5 38 204.0 39 211.5 40 219.0 41 249.5 42 280.0 43 286.0 44 292.0 45 308.0 46 324.0 47 341.0 48 358.0 49 333.0 50 308.0 51 300.0 52 292.0 53 267.0 54 242.0 55 221.0 56 200.0 57 197.0 58 194.0 59 177.5 60 161.0 61 142.0 62 123.0 63 122.0 64 121.0 65 105.5 66 90.0 67 83.0 68 76.0 69 62.0 70 48.0 71 44.5 72 41.0 73 33.0 74 25.0 75 22.5 76 20.0 77 17.0 78 14.0 79 10.0 80 6.0 81 4.5 82 3.0 83 2.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.600000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34326850214701 98.32499999999999 2 0.5556958827986865 1.0999999999999999 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097793 spots for SRR6322391.sra Written 1097793 spots for SRR6322391.sra Read 1097805 spots for SRR6322391.sra Written 1097805 spots for SRR6322391.sra SRR ids: ['SRR6322391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5h5qyveg SRR6322391.sra spots: 21955872 blocks: [[1, 1097793], [1097794, 2195586], [2195587, 3293379], [3293380, 4391172], [4391173, 5488965], [5488966, 6586758], [6586759, 7684551], [7684552, 8782344], [8782345, 9880137], [9880138, 10977930], [10977931, 12075723], [12075724, 13173516], [13173517, 14271309], [14271310, 15369102], [15369103, 16466895], [16466896, 17564688], [17564689, 18662481], [18662482, 19760274], [19760275, 20858067], [20858068, 21955872]] SRR6322391 file size 3816083 SRR6322391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322391 SRR6322391_1.fastq Input file: SRR6322391_1.fastq trimmed: SRR6322391-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:15:10 2024 >> started Sat Dec 7 10:15:25 2024 >> done (15.659s) 21955872 reads processed; of these: 5915 ( 0.03%) short reads filtered out after trimming by size control 136568 ( 0.62%) empty reads filtered out after trimming by size control 21813389 (99.35%) reads available; of these: 180807 ( 0.83%) trimmed reads available after processing 21632582 (99.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 295 0.00% 19 297 0.00% 20 363 0.00% 21 355 0.00% 22 480 0.00% 23 635 0.00% 24 3363 0.02% 25 2674 0.01% 26 1834 0.01% 27 1313 0.01% 28 829 0.00% 29 868 0.00% 30 1030 0.00% 31 942 0.00% 32 1044 0.00% 33 1143 0.01% 34 1220 0.01% 35 1365 0.01% 36 1569 0.01% 37 1805 0.01% 38 2138 0.01% 39 2464 0.01% 40 2951 0.01% 41 3654 0.02% 42 4821 0.02% 43 6212 0.03% 44 8321 0.04% 45 11095 0.05% 46 14851 0.07% 47 21208 0.10% 48 32381 0.15% 49 47287 0.22% 50 21632582 99.17% 21813389 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=17 prefix-density=0.49 prefix-fanout=1.9 sequence=GGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=20 fanout-score=103.78 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=7.7 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 10:15:39 Started mapping on | Dec 07 10:15:49 Finished on | Dec 07 10:16:09 Mapping speed, Million of reads per hour | 3926.41 Number of input reads | 21813389 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20820682 Uniquely mapped reads % | 95.45% Average mapped length | 49.78 Number of splices: Total | 3208216 Number of splices: Annotated (sjdb) | 3081746 Number of splices: GT/AG | 3169368 Number of splices: GC/AG | 31384 Number of splices: AT/AC | 2094 Number of splices: Non-canonical | 5370 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 538332 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 337492 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454375 454375 454375 N_multimapping 538332 538332 538332 N_noFeature 1002771 20230813 1141666 N_ambiguous 505853 1286 55477 UnstrandedReadsAssigned:19312058 PositiveStrandReadsAssigned:588583 NegativeStrandReadsAssigned:19623539 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322391 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322391-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,813,389 reads, 19,524,134 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR6322391.ke.tsv 35125 SRR6322391.se.tsv 88098 total ==> SRR6322391.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.09804e-05 7.33049e-06 PNS24247 1044 945 60.7751 5.55922 PNS24249 1928 1829 29.6163 1.39971 PNS24246 1044 945 60.7751 5.55922 PNS24248 1044 945 60.7751 5.55922 PNS24244 1471 1372 74.0582 4.66594 PNS24243 293 194 0 0 KQK14069 1603 1504 1736.54 99.806 KQK14071 474 375 602.048 138.778 ==> SRR6322391.se.tsv <== BRADI_1g14170v3 2643 BRADI_1g53295v3 222 BRADI_1g59795v3 456 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 6832 BRADI_1g74790v3 35 BRADI_1g09890v3 0 BRADI_1g77505v3 416 BRADI_1g48960v3 0 SRR6322391 completed mapping pipeline successfully