Starting /dee2/code/volunteer_pipeline.sh SRR6322392 current disk space = 1543752802304 free memory = 1599772416 SRR6322392 SRAfilesize 23d435c5d41b20216608cd88889d9368 SRR6322392.sra SRR6322392.sra file validated SRR6322392 is single end SRR6322392 is conventional basespace SRR6322392 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.407 33.0 32.0 34.0 2.0 34.0 2 32.02725 34.0 32.0 34.0 27.0 34.0 3 32.31225 34.0 32.0 34.0 27.0 34.0 4 32.7075 34.0 33.0 34.0 32.0 34.0 5 32.71375 34.0 33.0 34.0 32.0 34.0 6 36.60375 38.0 37.0 38.0 34.0 38.0 7 37.056 38.0 38.0 38.0 36.0 38.0 8 37.16325 38.0 38.0 38.0 36.0 38.0 9 37.30075 38.0 38.0 38.0 37.0 38.0 10 37.26025 38.0 38.0 38.0 37.0 38.0 11 37.223 38.0 38.0 38.0 37.0 38.0 12 37.1815 38.0 38.0 38.0 37.0 38.0 13 37.216 38.0 38.0 38.0 37.0 38.0 14 37.27625 38.0 38.0 38.0 37.0 38.0 15 37.2795 38.0 38.0 38.0 37.0 38.0 16 37.15275 38.0 38.0 38.0 37.0 38.0 17 37.27225 38.0 38.0 38.0 37.0 38.0 18 37.238 38.0 38.0 38.0 37.0 38.0 19 37.20625 38.0 38.0 38.0 37.0 38.0 20 37.10275 38.0 38.0 38.0 37.0 38.0 21 37.087 38.0 38.0 38.0 36.0 38.0 22 37.1905 38.0 38.0 38.0 37.0 38.0 23 37.27375 38.0 38.0 38.0 37.0 38.0 24 37.19925 38.0 38.0 38.0 37.0 38.0 25 37.171 38.0 38.0 38.0 37.0 38.0 26 37.11975 38.0 38.0 38.0 36.0 38.0 27 37.18025 38.0 38.0 38.0 37.0 38.0 28 37.07375 38.0 38.0 38.0 37.0 38.0 29 37.076 38.0 38.0 38.0 36.0 38.0 30 36.99 38.0 38.0 38.0 36.0 38.0 31 37.10325 38.0 38.0 38.0 37.0 38.0 32 37.01325 38.0 38.0 38.0 36.0 38.0 33 37.0625 38.0 38.0 38.0 37.0 38.0 34 37.09475 38.0 38.0 38.0 37.0 38.0 35 37.06325 38.0 38.0 38.0 36.0 38.0 36 37.0875 38.0 38.0 38.0 37.0 38.0 37 36.963 38.0 38.0 38.0 36.0 38.0 38 36.95975 38.0 38.0 38.0 36.0 38.0 39 36.946 38.0 38.0 38.0 36.0 38.0 40 36.9255 38.0 38.0 38.0 36.0 38.0 41 37.02525 38.0 38.0 38.0 36.0 38.0 42 37.06125 38.0 38.0 38.0 37.0 38.0 43 37.0495 38.0 38.0 38.0 36.0 38.0 44 37.082 38.0 38.0 38.0 36.0 38.0 45 37.09375 38.0 38.0 38.0 36.0 38.0 46 37.08075 38.0 38.0 38.0 36.0 38.0 47 37.09425 38.0 38.0 38.0 36.0 38.0 48 37.0575 38.0 38.0 38.0 36.0 38.0 49 37.0635 38.0 38.0 38.0 36.0 38.0 50 37.048 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 3.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 0.0 22 3.0 23 2.0 24 1.0 25 10.0 26 12.0 27 5.0 28 17.0 29 21.0 30 52.0 31 49.0 32 61.0 33 69.0 34 117.0 35 205.0 36 756.0 37 2607.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.90417762196903 10.750803388840199 9.406952965235174 43.9380660239556 2 25.525 12.975 34.150000000000006 27.35 3 21.25 14.325 25.924999999999997 38.5 4 25.45 21.925 21.2 31.424999999999997 5 28.225 23.849999999999998 22.825 25.1 6 25.5 29.9 22.45 22.15 7 19.650000000000002 24.099999999999998 36.55 19.7 8 22.650000000000002 23.474999999999998 27.250000000000004 26.625 9 21.7 21.45 32.45 24.4 10 22.25 32.725 24.775 20.25 11 27.650000000000002 22.875 21.224999999999998 28.249999999999996 12 24.325 22.15 25.7 27.825 13 22.625 25.074999999999996 26.450000000000003 25.85 14 23.175 23.75 26.0 27.075 15 23.425 23.375 26.3 26.900000000000002 16 24.95 22.650000000000002 25.624999999999996 26.775 17 24.05 25.124999999999996 25.324999999999996 25.5 18 22.975 23.775 25.974999999999998 27.275 19 24.0 23.75 25.15 27.1 20 24.15 24.7 25.3 25.85 21 23.400000000000002 25.2 25.4 26.0 22 24.125 25.5 24.275 26.1 23 24.175 24.8 25.2 25.825 24 24.125 23.1 25.275 27.500000000000004 25 24.025 24.925 24.8 26.25 26 24.275 25.25 24.2 26.275 27 23.225 24.099999999999998 25.1 27.575 28 24.0 24.175 24.325 27.500000000000004 29 24.625 25.2 24.45 25.724999999999998 30 24.775 23.75 24.95 26.525 31 24.05 24.375 23.825 27.750000000000004 32 23.575 25.074999999999996 24.4 26.950000000000003 33 24.45 22.85 25.674999999999997 27.025 34 25.25 23.75 24.3 26.700000000000003 35 24.625 25.224999999999998 24.625 25.525 36 23.625 24.575 24.7 27.1 37 24.224999999999998 24.3 24.575 26.900000000000002 38 24.55 24.474999999999998 24.7 26.275 39 25.525 22.125 24.8 27.55 40 23.575 23.849999999999998 25.825 26.75 41 24.0 25.224999999999998 24.375 26.400000000000002 42 24.474999999999998 23.974999999999998 24.3 27.250000000000004 43 24.925 23.575 25.35 26.150000000000002 44 23.825 24.075 26.075 26.025 45 23.825 23.5 25.074999999999996 27.6 46 23.35 23.875 25.025 27.750000000000004 47 25.95 23.05 26.3 24.7 48 24.775 23.825 25.6 25.8 49 24.6 24.45 24.45 26.5 50 24.474999999999998 24.85 24.175 26.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 4.5 24 6.0 25 6.5 26 7.0 27 10.0 28 13.0 29 23.0 30 33.0 31 43.0 32 53.0 33 61.5 34 70.0 35 93.0 36 116.0 37 134.0 38 152.0 39 196.5 40 241.0 41 240.5 42 240.0 43 259.5 44 279.0 45 284.5 46 290.0 47 309.0 48 328.0 49 324.0 50 320.0 51 302.5 52 285.0 53 261.5 54 238.0 55 235.0 56 232.0 57 224.0 58 216.0 59 193.0 60 170.0 61 160.5 62 151.0 63 133.0 64 115.0 65 103.5 66 92.0 67 89.5 68 87.0 69 82.0 70 77.0 71 75.0 72 73.0 73 57.5 74 42.0 75 31.0 76 20.0 77 23.0 78 26.0 79 20.5 80 15.0 81 9.0 82 3.0 83 4.0 84 5.0 85 3.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.424999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36724879777272 98.15 2 0.5568210579600101 1.0999999999999999 3 0.02531004808909137 0.075 4 0.0 0.0 5 0.0 0.0 6 0.02531004808909137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02531004808909137 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 21 0.525 TruSeq Adapter, Index 19 (97% over 40bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 6 0.15 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184262 spots for SRR6322392.sra Written 1184262 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra Read 1184259 spots for SRR6322392.sra Written 1184259 spots for SRR6322392.sra SRR ids: ['SRR6322392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9i5gc2fk SRR6322392.sra spots: 23685183 blocks: [[1, 1184259], [1184260, 2368518], [2368519, 3552777], [3552778, 4737036], [4737037, 5921295], [5921296, 7105554], [7105555, 8289813], [8289814, 9474072], [9474073, 10658331], [10658332, 11842590], [11842591, 13026849], [13026850, 14211108], [14211109, 15395367], [15395368, 16579626], [16579627, 17763885], [17763886, 18948144], [18948145, 20132403], [20132404, 21316662], [21316663, 22500921], [22500922, 23685183]] SRR6322392 file size 4117508 SRR6322392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322392 SRR6322392_1.fastq Input file: SRR6322392_1.fastq trimmed: SRR6322392-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:16:06 2024 >> started Sat Dec 7 10:16:22 2024 >> done (15.620s) 23685183 reads processed; of these: 5920 ( 0.02%) short reads filtered out after trimming by size control 213023 ( 0.90%) empty reads filtered out after trimming by size control 23466240 (99.08%) reads available; of these: 200710 ( 0.86%) trimmed reads available after processing 23265530 (99.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 356 0.00% 19 299 0.00% 20 371 0.00% 21 387 0.00% 22 462 0.00% 23 589 0.00% 24 3585 0.02% 25 2769 0.01% 26 1968 0.01% 27 1443 0.01% 28 847 0.00% 29 926 0.00% 30 1003 0.00% 31 1030 0.00% 32 1095 0.00% 33 1167 0.00% 34 1267 0.01% 35 1390 0.01% 36 1636 0.01% 37 1850 0.01% 38 2354 0.01% 39 2635 0.01% 40 3238 0.01% 41 4152 0.02% 42 5165 0.02% 43 6729 0.03% 44 9096 0.04% 45 11974 0.05% 46 16740 0.07% 47 23705 0.10% 48 36928 0.16% 49 53554 0.23% 50 23265530 99.14% 23466240 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=2.4 sequence=TGGTGTTGGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=243.48 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=9.8 sequence=CGCCGCCGCCAGGCTCTTCACGCCGTTGCAGCACGCCGCCGACGGGGACGCGCCCGTCCCCCTGGCGTAGCTCAGGCACGGCCCCACCGCCGAGTTCACCTGGCCGCAGCTGATGGCCGCGTCGGTGACGAAGGCGGAGAGGAGCAGGGCCGCCATGGCTGCGAGCAGGACGAGCTGGGCTGCTGATGCGCGCGCCATTGGTGAGAGGTGGAAACTCTGGAGATGGAGGGCTTGGATTTGGGTTGTGGGAGATGGAG Started job on | Dec 07 10:16:41 Started mapping on | Dec 07 10:16:41 Finished on | Dec 07 10:17:04 Mapping speed, Million of reads per hour | 3672.98 Number of input reads | 23466240 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 22567287 Uniquely mapped reads % | 96.17% Average mapped length | 49.75 Number of splices: Total | 3405031 Number of splices: Annotated (sjdb) | 3270437 Number of splices: GT/AG | 3364777 Number of splices: GC/AG | 33773 Number of splices: AT/AC | 1915 Number of splices: Non-canonical | 4566 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522445 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 263925 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376508 376508 376508 N_multimapping 522445 522445 522445 N_noFeature 816298 21932180 959724 N_ambiguous 536733 1329 45692 UnstrandedReadsAssigned:21214256 PositiveStrandReadsAssigned:633778 NegativeStrandReadsAssigned:21561871 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322392 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322392-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,466,240 reads, 21,416,879 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52973 SRR6322392.ke.tsv 35125 SRR6322392.se.tsv 88098 total ==> SRR6322392.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 21.2754 1.90439 PNS24247 1044 945 51.4892 4.08213 PNS24249 1928 1829 22.1195 0.906076 PNS24246 1044 945 51.4892 4.08213 PNS24248 1044 945 51.4892 4.08213 PNS24244 1471 1372 70.1375 3.83001 PNS24243 293 194 0 0 KQK14069 1603 1504 3845.34 191.553 KQK14071 474 375 1641.55 327.964 ==> SRR6322392.se.tsv <== BRADI_1g14170v3 5983 BRADI_1g53295v3 160 BRADI_1g59795v3 283 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 8155 BRADI_1g74790v3 43 BRADI_1g09890v3 0 BRADI_1g77505v3 387 BRADI_1g48960v3 0 SRR6322392 completed mapping pipeline successfully