Starting /dee2/code/volunteer_pipeline.sh SRR6322393 current disk space = 1543822483456 free memory = 1593307708 SRR6322393 SRAfilesize 30fa639e69ca332c60f6c9e34409ad82 SRR6322393.sra SRR6322393.sra file validated SRR6322393 is single end SRR6322393 is conventional basespace SRR6322393 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.50775 34.0 32.0 34.0 2.0 34.0 2 32.10925 34.0 32.0 34.0 27.0 34.0 3 32.323 34.0 32.0 34.0 28.0 34.0 4 32.65725 34.0 33.0 34.0 32.0 34.0 5 32.781 34.0 33.0 34.0 32.0 34.0 6 36.60925 38.0 37.0 38.0 34.0 38.0 7 36.9 38.0 38.0 38.0 36.0 38.0 8 37.0495 38.0 38.0 38.0 36.0 38.0 9 37.10775 38.0 38.0 38.0 37.0 38.0 10 37.11 38.0 38.0 38.0 37.0 38.0 11 37.13725 38.0 38.0 38.0 37.0 38.0 12 37.11275 38.0 38.0 38.0 37.0 38.0 13 36.98275 38.0 38.0 38.0 36.0 38.0 14 36.96375 38.0 38.0 38.0 37.0 38.0 15 37.064 38.0 38.0 38.0 37.0 38.0 16 37.022 38.0 38.0 38.0 37.0 38.0 17 37.1005 38.0 38.0 38.0 37.0 38.0 18 37.062 38.0 38.0 38.0 37.0 38.0 19 37.05875 38.0 38.0 38.0 37.0 38.0 20 37.10725 38.0 38.0 38.0 37.0 38.0 21 37.1085 38.0 38.0 38.0 37.0 38.0 22 37.06275 38.0 38.0 38.0 37.0 38.0 23 37.055 38.0 38.0 38.0 37.0 38.0 24 37.04175 38.0 38.0 38.0 37.0 38.0 25 37.01125 38.0 38.0 38.0 37.0 38.0 26 36.9145 38.0 38.0 38.0 36.0 38.0 27 36.96225 38.0 38.0 38.0 36.0 38.0 28 36.98075 38.0 38.0 38.0 37.0 38.0 29 37.024 38.0 38.0 38.0 37.0 38.0 30 37.02225 38.0 38.0 38.0 37.0 38.0 31 36.9835 38.0 38.0 38.0 37.0 38.0 32 36.997 38.0 38.0 38.0 37.0 38.0 33 36.9655 38.0 38.0 38.0 36.0 38.0 34 36.9315 38.0 38.0 38.0 36.0 38.0 35 36.885 38.0 38.0 38.0 36.0 38.0 36 36.963 38.0 38.0 38.0 36.0 38.0 37 36.9885 38.0 38.0 38.0 37.0 38.0 38 37.0655 38.0 38.0 38.0 37.0 38.0 39 36.85925 38.0 38.0 38.0 36.0 38.0 40 36.84275 38.0 38.0 38.0 36.0 38.0 41 36.8565 38.0 38.0 38.0 36.0 38.0 42 36.899 38.0 38.0 38.0 36.0 38.0 43 36.839 38.0 38.0 38.0 36.0 38.0 44 36.7435 38.0 38.0 38.0 36.0 38.0 45 36.79675 38.0 38.0 38.0 36.0 38.0 46 36.87725 38.0 38.0 38.0 36.0 38.0 47 36.884 38.0 38.0 38.0 37.0 38.0 48 36.903 38.0 38.0 38.0 37.0 38.0 49 36.8475 38.0 38.0 38.0 36.0 38.0 50 36.80725 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 1.0 19 2.0 20 0.0 21 2.0 22 2.0 23 5.0 24 4.0 25 5.0 26 6.0 27 7.0 28 19.0 29 26.0 30 37.0 31 37.0 32 51.0 33 87.0 34 112.0 35 192.0 36 735.0 37 2640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.93375944218477 9.558396281231841 9.965136548518304 46.54270772806508 2 21.935967983991997 15.532766383191596 35.41770885442722 27.113556778389196 3 18.224999999999998 14.249999999999998 27.925 39.6 4 23.95 21.75 20.599999999999998 33.7 5 26.674999999999997 27.425 24.525 21.375 6 22.400000000000002 30.45 26.0 21.15 7 18.05 25.5 37.375 19.075 8 19.075 25.825 29.875 25.224999999999998 9 20.625 22.3 32.35 24.725 10 20.375 35.85 23.674999999999997 20.1 11 26.650000000000002 25.0 22.775000000000002 25.575 12 21.15 22.275 27.250000000000004 29.325000000000003 13 20.474999999999998 27.925 26.5 25.1 14 22.2 24.45 25.924999999999997 27.425 15 21.7 27.250000000000004 25.474999999999998 25.575 16 22.35 24.474999999999998 25.275 27.900000000000002 17 24.5 25.3 24.95 25.25 18 21.775 25.05 28.675 24.5 19 22.175 24.575 24.425 28.825 20 22.075 25.124999999999996 28.525 24.275 21 24.575 25.374999999999996 24.95 25.1 22 21.525 27.075 25.874999999999996 25.525 23 22.175 27.325 26.3 24.2 24 20.925 24.675 25.650000000000002 28.749999999999996 25 21.05 26.6 26.275 26.075 26 22.375 24.45 25.874999999999996 27.3 27 20.549999999999997 25.924999999999997 25.324999999999996 28.199999999999996 28 22.35 27.3 25.15 25.2 29 24.85 25.974999999999998 24.75 24.425 30 22.8 24.125 27.85 25.224999999999998 31 22.8 24.075 24.7 28.425 32 22.15 28.449999999999996 24.8 24.6 33 22.475 24.075 25.374999999999996 28.075 34 22.675 27.650000000000002 24.125 25.55 35 22.85 25.25 27.925 23.974999999999998 36 24.099999999999998 25.924999999999997 24.975 25.0 37 22.35 26.174999999999997 26.85 24.625 38 22.475 25.224999999999998 24.9 27.400000000000002 39 21.95 27.725 25.224999999999998 25.1 40 24.45 26.3 23.825 25.424999999999997 41 22.35 30.125 23.925 23.599999999999998 42 22.425 28.000000000000004 25.624999999999996 23.95 43 22.85 24.8 26.474999999999998 25.874999999999996 44 22.975 24.675 25.374999999999996 26.974999999999998 45 21.65 25.85 27.400000000000002 25.1 46 22.725 24.075 25.374999999999996 27.825 47 24.925 26.575 24.0 24.5 48 21.775 25.174999999999997 28.175 24.875 49 23.775 27.05 24.45 24.725 50 22.025 26.375 27.150000000000002 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.5 24 7.0 25 11.5 26 16.0 27 18.0 28 20.0 29 28.5 30 37.0 31 42.0 32 47.0 33 75.5 34 104.0 35 130.5 36 157.0 37 183.5 38 210.0 39 225.5 40 241.0 41 273.5 42 306.0 43 327.5 44 349.0 45 350.0 46 351.0 47 377.5 48 404.0 49 353.5 50 303.0 51 290.0 52 277.0 53 254.0 54 231.0 55 216.5 56 202.0 57 184.5 58 167.0 59 153.0 60 139.0 61 126.0 62 113.0 63 95.0 64 77.0 65 73.0 66 69.0 67 58.5 68 48.0 69 48.0 70 48.0 71 36.0 72 24.0 73 25.0 74 26.0 75 19.5 76 13.0 77 9.0 78 5.0 79 5.0 80 5.0 81 3.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.950000000000001 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.22420480993019 95.92500000000001 2 0.6464959917248514 1.25 3 0.02585983966899405 0.075 4 0.0517196793379881 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02585983966899405 0.3 >50 0.02585983966899405 2.25 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 90 2.25 TruSeq Adapter, Index 15 (97% over 40bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 12 0.3 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418147 spots for SRR6322393.sra Written 1418147 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra Read 1418135 spots for SRR6322393.sra Written 1418135 spots for SRR6322393.sra SRR ids: ['SRR6322393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2dxi5npa SRR6322393.sra spots: 28362712 blocks: [[1, 1418135], [1418136, 2836270], [2836271, 4254405], [4254406, 5672540], [5672541, 7090675], [7090676, 8508810], [8508811, 9926945], [9926946, 11345080], [11345081, 12763215], [12763216, 14181350], [14181351, 15599485], [15599486, 17017620], [17017621, 18435755], [18435756, 19853890], [19853891, 21272025], [21272026, 22690160], [22690161, 24108295], [24108296, 25526430], [25526431, 26944565], [26944566, 28362712]] SRR6322393 file size 4932800 SRR6322393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322393 SRR6322393_1.fastq Input file: SRR6322393_1.fastq trimmed: SRR6322393-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:13:48 2024 >> started Sat Dec 7 10:14:09 2024 >> done (21.079s) 28362712 reads processed; of these: 14463 ( 0.05%) short reads filtered out after trimming by size control 933494 ( 3.29%) empty reads filtered out after trimming by size control 27414755 (96.66%) reads available; of these: 238725 ( 0.87%) trimmed reads available after processing 27176030 (99.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 604 0.00% 19 650 0.00% 20 686 0.00% 21 735 0.00% 22 912 0.00% 23 1041 0.00% 24 3763 0.01% 25 4734 0.02% 26 2677 0.01% 27 2985 0.01% 28 1333 0.00% 29 1503 0.01% 30 2517 0.01% 31 1608 0.01% 32 1632 0.01% 33 1752 0.01% 34 1900 0.01% 35 2036 0.01% 36 2513 0.01% 37 2688 0.01% 38 3238 0.01% 39 3658 0.01% 40 4267 0.02% 41 5791 0.02% 42 6946 0.03% 43 8438 0.03% 44 11145 0.04% 45 14643 0.05% 46 20036 0.07% 47 29278 0.11% 48 38340 0.14% 49 54676 0.20% 50 27176030 99.13% 27414755 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=2.1 sequence=TGGTGTTGGTGTAGTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=83.71 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.7 sequence=CCGCCGCCGCCCCCGCCGCGCCAGCCGTCCTGGATGCCGGCGCTGTTGGTGCTCACCTTCTCCTCCTTGTCATGAGTTTGCTCGGCGGGCGCCGCCGTGGTGAGGAGGACGGCCGACGCGAGGAGGACGG Started job on | Dec 07 10:14:22 Started mapping on | Dec 07 10:14:23 Finished on | Dec 07 10:14:51 Mapping speed, Million of reads per hour | 3524.75 Number of input reads | 27414755 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 25655591 Uniquely mapped reads % | 93.58% Average mapped length | 49.77 Number of splices: Total | 4028898 Number of splices: Annotated (sjdb) | 3884502 Number of splices: GT/AG | 3978857 Number of splices: GC/AG | 41558 Number of splices: AT/AC | 2720 Number of splices: Non-canonical | 5763 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 756603 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 577056 % of reads mapped to too many loci | 2.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1002561 1002561 1002561 N_multimapping 756603 756603 756603 N_noFeature 1303984 24899675 1476095 N_ambiguous 652983 1765 69488 UnstrandedReadsAssigned:23698624 PositiveStrandReadsAssigned:754151 NegativeStrandReadsAssigned:24110008 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322393 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322393-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,414,755 reads, 23,922,808 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR6322393.ke.tsv 35125 SRR6322393.se.tsv 88098 total ==> SRR6322393.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 5.01696 0.426453 PNS24247 1044 945 82.9144 6.24243 PNS24249 1928 1829 3.79758 0.147723 PNS24246 1044 945 82.9144 6.24243 PNS24248 1044 945 82.9144 6.24243 PNS24244 1471 1372 111.442 5.77899 PNS24243 293 194 0 0 KQK14069 1603 1504 634.89 30.0335 KQK14071 474 375 244.429 46.3744 ==> SRR6322393.se.tsv <== BRADI_1g14170v3 1051 BRADI_1g53295v3 276 BRADI_1g59795v3 750 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 7976 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 544 BRADI_1g48960v3 0 SRR6322393 completed mapping pipeline successfully