Starting /dee2/code/volunteer_pipeline.sh SRR6322394 current disk space = 1543015772160 free memory = 1599432356 SRR6322394 SRAfilesize c17600f3a0ff36effd278f3102a16609 SRR6322394.sra SRR6322394.sra file validated SRR6322394 is single end SRR6322394 is conventional basespace SRR6322394 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.189 33.0 27.0 34.0 2.0 34.0 2 31.61375 33.0 28.0 34.0 27.0 34.0 3 31.98675 33.0 32.0 34.0 27.0 34.0 4 32.55175 34.0 33.0 34.0 32.0 34.0 5 32.72525 33.0 33.0 34.0 32.0 34.0 6 36.631 38.0 37.0 38.0 34.0 38.0 7 37.0105 38.0 38.0 38.0 36.0 38.0 8 37.103 38.0 38.0 38.0 36.0 38.0 9 37.25825 38.0 38.0 38.0 37.0 38.0 10 37.19075 38.0 38.0 38.0 37.0 38.0 11 37.2035 38.0 38.0 38.0 37.0 38.0 12 37.1625 38.0 38.0 38.0 37.0 38.0 13 37.228 38.0 38.0 38.0 37.0 38.0 14 37.1855 38.0 38.0 38.0 36.0 38.0 15 37.2355 38.0 38.0 38.0 37.0 38.0 16 37.2065 38.0 38.0 38.0 36.0 38.0 17 37.19375 38.0 38.0 38.0 37.0 38.0 18 37.2185 38.0 38.0 38.0 37.0 38.0 19 37.218 38.0 38.0 38.0 37.0 38.0 20 37.29075 38.0 38.0 38.0 37.0 38.0 21 37.20575 38.0 38.0 38.0 37.0 38.0 22 37.248 38.0 38.0 38.0 37.0 38.0 23 37.15875 38.0 38.0 38.0 36.0 38.0 24 37.23775 38.0 38.0 38.0 37.0 38.0 25 37.1155 38.0 38.0 38.0 36.0 38.0 26 37.0165 38.0 38.0 38.0 36.0 38.0 27 37.0695 38.0 38.0 38.0 36.0 38.0 28 37.00875 38.0 38.0 38.0 36.0 38.0 29 37.002 38.0 38.0 38.0 36.0 38.0 30 36.9485 38.0 38.0 38.0 36.0 38.0 31 37.042 38.0 38.0 38.0 36.0 38.0 32 36.89925 38.0 38.0 38.0 36.0 38.0 33 36.9945 38.0 38.0 38.0 36.0 38.0 34 36.982 38.0 38.0 38.0 36.0 38.0 35 37.01475 38.0 38.0 38.0 36.0 38.0 36 36.94875 38.0 38.0 38.0 36.0 38.0 37 36.9515 38.0 38.0 38.0 36.0 38.0 38 36.89725 38.0 38.0 38.0 36.0 38.0 39 36.89425 38.0 38.0 38.0 36.0 38.0 40 36.85425 38.0 38.0 38.0 36.0 38.0 41 36.9265 38.0 38.0 38.0 36.0 38.0 42 37.0435 38.0 38.0 38.0 36.0 38.0 43 36.9705 38.0 38.0 38.0 36.0 38.0 44 37.0655 38.0 38.0 38.0 36.0 38.0 45 37.04475 38.0 38.0 38.0 36.0 38.0 46 36.99175 38.0 38.0 38.0 36.0 38.0 47 36.99525 38.0 38.0 38.0 36.0 38.0 48 37.0515 38.0 38.0 38.0 37.0 38.0 49 36.9265 38.0 38.0 38.0 36.0 38.0 50 36.89925 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 4.0 24 3.0 25 6.0 26 15.0 27 16.0 28 17.0 29 26.0 30 45.0 31 59.0 32 59.0 33 93.0 34 133.0 35 202.0 36 956.0 37 2354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.95055821371611 9.441786283891547 6.7304625199362045 50.877192982456144 2 19.775000000000002 11.275 43.075 25.874999999999996 3 18.875 14.35 25.4 41.375 4 25.7 22.675 22.05 29.575000000000003 5 27.200000000000003 26.650000000000002 25.825 20.325 6 21.45 31.624999999999996 23.849999999999998 23.075000000000003 7 17.925 24.75 39.375 17.95 8 19.55 23.05 32.574999999999996 24.825 9 19.45 20.200000000000003 35.225 25.124999999999996 10 20.9 34.5 25.874999999999996 18.725 11 25.0 26.0 23.175 25.825 12 22.1 22.05 27.474999999999998 28.375 13 23.275000000000002 25.525 26.275 24.925 14 22.525000000000002 25.900000000000002 26.5 25.074999999999996 15 21.7 24.625 26.8 26.875 16 23.025000000000002 26.775 25.474999999999998 24.725 17 24.725 24.3 25.8 25.174999999999997 18 21.975 25.2 26.55 26.275 19 23.875 25.85 25.3 24.975 20 22.75 26.275 25.85 25.124999999999996 21 22.05 25.825 25.8 26.325 22 22.375 27.6 24.4 25.624999999999996 23 22.55 26.525 26.3 24.625 24 21.125 25.7 26.0 27.175 25 22.650000000000002 25.424999999999997 25.624999999999996 26.3 26 21.675 25.5 26.724999999999998 26.1 27 23.200000000000003 24.825 24.9 27.075 28 22.0 25.6 25.95 26.450000000000003 29 23.25 25.124999999999996 26.6 25.025 30 22.3 24.975 26.075 26.650000000000002 31 22.75 27.650000000000002 24.45 25.15 32 22.375 27.625 24.099999999999998 25.900000000000002 33 21.925 24.375 25.05 28.65 34 22.05 26.85 25.15 25.95 35 21.9 26.150000000000002 26.325 25.624999999999996 36 23.025000000000002 25.15 25.4 26.424999999999997 37 23.175 26.3 25.224999999999998 25.3 38 22.7 25.324999999999996 26.3 25.674999999999997 39 21.0 26.35 25.724999999999998 26.924999999999997 40 23.225 26.05 24.125 26.6 41 23.75 25.8 26.150000000000002 24.3 42 22.15 25.374999999999996 25.45 27.025 43 23.0 27.6 23.65 25.75 44 22.25 26.474999999999998 26.75 24.525 45 23.125 24.55 26.875 25.45 46 23.575 25.525 24.75 26.150000000000002 47 24.275 25.6 25.074999999999996 25.05 48 21.3 26.275 25.474999999999998 26.950000000000003 49 23.0 27.375 24.5 25.124999999999996 50 22.825 25.3 26.650000000000002 25.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 2.0 20 2.0 21 4.5 22 7.0 23 6.0 24 5.0 25 12.5 26 20.0 27 22.5 28 25.0 29 30.0 30 35.0 31 52.5 32 70.0 33 90.5 34 111.0 35 132.0 36 153.0 37 176.0 38 199.0 39 226.5 40 254.0 41 278.0 42 302.0 43 321.5 44 341.0 45 333.0 46 325.0 47 333.5 48 342.0 49 309.5 50 277.0 51 272.5 52 268.0 53 259.0 54 250.0 55 259.5 56 269.0 57 219.5 58 170.0 59 157.0 60 144.0 61 124.5 62 105.0 63 98.0 64 91.0 65 83.5 66 76.0 67 66.0 68 56.0 69 46.0 70 36.0 71 30.0 72 24.0 73 24.0 74 24.0 75 18.0 76 12.0 77 6.5 78 1.0 79 1.5 80 2.0 81 1.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29078014184397 98.0 2 0.6585612968591692 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 16 (97% over 40bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 6 0.15 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783915 spots for SRR6322394.sra Written 1783915 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra Read 1783902 spots for SRR6322394.sra Written 1783902 spots for SRR6322394.sra SRR ids: ['SRR6322394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iw79dn58 SRR6322394.sra spots: 35678053 blocks: [[1, 1783902], [1783903, 3567804], [3567805, 5351706], [5351707, 7135608], [7135609, 8919510], [8919511, 10703412], [10703413, 12487314], [12487315, 14271216], [14271217, 16055118], [16055119, 17839020], [17839021, 19622922], [19622923, 21406824], [21406825, 23190726], [23190727, 24974628], [24974629, 26758530], [26758531, 28542432], [28542433, 30326334], [30326335, 32110236], [32110237, 33894138], [33894139, 35678053]] SRR6322394 file size 6207877 SRR6322394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322394 SRR6322394_1.fastq Input file: SRR6322394_1.fastq trimmed: SRR6322394-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:59:36 2024 >> started Sat Dec 7 12:00:00 2024 >> done (23.255s) 35678053 reads processed; of these: 11819 ( 0.03%) short reads filtered out after trimming by size control 342984 ( 0.96%) empty reads filtered out after trimming by size control 35323250 (99.01%) reads available; of these: 288680 ( 0.82%) trimmed reads available after processing 35034570 (99.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 529 0.00% 19 548 0.00% 20 598 0.00% 21 622 0.00% 22 897 0.00% 23 1101 0.00% 24 5338 0.02% 25 4388 0.01% 26 3036 0.01% 27 2233 0.01% 28 1450 0.00% 29 1453 0.00% 30 1716 0.00% 31 1631 0.00% 32 1734 0.00% 33 1938 0.01% 34 2358 0.01% 35 2498 0.01% 36 2601 0.01% 37 3080 0.01% 38 3679 0.01% 39 4656 0.01% 40 5368 0.02% 41 6146 0.02% 42 7909 0.02% 43 10211 0.03% 44 13279 0.04% 45 17546 0.05% 46 23956 0.07% 47 33775 0.10% 48 50905 0.14% 49 71501 0.20% 50 35034570 99.18% 35323250 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=2.1 sequence=TGGTGTTGGTGTAGTGCCGTAAGTTGGTGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=79.29 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.4 sequence=CTCCTCCTCCACGGCCTGGGTAACCACGGCCCGGATATCCGCCGCCGCC Started job on | Dec 07 12:00:10 Started mapping on | Dec 07 12:00:10 Finished on | Dec 07 12:00:35 Mapping speed, Million of reads per hour | 5086.55 Number of input reads | 35323250 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 33631083 Uniquely mapped reads % | 95.21% Average mapped length | 49.79 Number of splices: Total | 5343556 Number of splices: Annotated (sjdb) | 5148422 Number of splices: GT/AG | 5278787 Number of splices: GC/AG | 52475 Number of splices: AT/AC | 4051 Number of splices: Non-canonical | 8243 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 944655 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 499347 % of reads mapped to too many loci | 1.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747512 747512 747512 N_multimapping 944655 944655 944655 N_noFeature 1651946 32692721 1837832 N_ambiguous 837160 2068 85546 UnstrandedReadsAssigned:31141977 PositiveStrandReadsAssigned:936294 NegativeStrandReadsAssigned:31707705 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322394 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322394-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,323,250 reads, 31,619,192 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52973 SRR6322394.ke.tsv 35125 SRR6322394.se.tsv 88098 total ==> SRR6322394.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 6.23834e-07 4.12223e-08 PNS24247 1044 945 93.8634 5.49354 PNS24249 1928 1829 0 0 PNS24246 1044 945 93.8634 5.49354 PNS24248 1044 945 93.8634 5.49354 PNS24244 1471 1372 201.41 8.11923 PNS24243 293 194 0 0 KQK14069 1603 1504 1168.79 42.9809 KQK14071 474 375 344.468 50.805 ==> SRR6322394.se.tsv <== BRADI_1g14170v3 1881 BRADI_1g53295v3 394 BRADI_1g59795v3 900 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 10729 BRADI_1g74790v3 71 BRADI_1g09890v3 0 BRADI_1g77505v3 683 BRADI_1g48960v3 0 SRR6322394 completed mapping pipeline successfully