Starting /dee2/code/volunteer_pipeline.sh SRR6322395 current disk space = 1543011958784 free memory = 1596622744 SRR6322395 SRAfilesize 079af1b8b146209ab61e8db96109c0ce SRR6322395.sra SRR6322395.sra file validated SRR6322395 is single end SRR6322395 is conventional basespace SRR6322395 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0545 34.0 33.0 34.0 18.0 34.0 2 32.4245 34.0 33.0 34.0 28.0 34.0 3 32.572 34.0 33.0 34.0 28.0 34.0 4 32.801 34.0 33.0 34.0 32.0 34.0 5 32.8895 34.0 33.0 34.0 32.0 34.0 6 36.81275 38.0 37.0 38.0 35.0 38.0 7 37.061 38.0 38.0 38.0 36.0 38.0 8 37.09725 38.0 38.0 38.0 37.0 38.0 9 37.25525 38.0 38.0 38.0 37.0 38.0 10 37.2705 38.0 38.0 38.0 37.0 38.0 11 37.30975 38.0 38.0 38.0 37.0 38.0 12 37.2795 38.0 38.0 38.0 37.0 38.0 13 37.233 38.0 38.0 38.0 37.0 38.0 14 37.171 38.0 38.0 38.0 37.0 38.0 15 37.2665 38.0 38.0 38.0 37.0 38.0 16 37.25875 38.0 38.0 38.0 37.0 38.0 17 37.234 38.0 38.0 38.0 37.0 38.0 18 37.2005 38.0 38.0 38.0 37.0 38.0 19 37.29175 38.0 38.0 38.0 37.0 38.0 20 37.26225 38.0 38.0 38.0 37.0 38.0 21 37.29175 38.0 38.0 38.0 37.0 38.0 22 37.237 38.0 38.0 38.0 37.0 38.0 23 37.25525 38.0 38.0 38.0 37.0 38.0 24 37.171 38.0 38.0 38.0 37.0 38.0 25 37.1745 38.0 38.0 38.0 37.0 38.0 26 37.154 38.0 38.0 38.0 37.0 38.0 27 37.24275 38.0 38.0 38.0 37.0 38.0 28 37.16675 38.0 38.0 38.0 37.0 38.0 29 37.19 38.0 38.0 38.0 37.0 38.0 30 37.19575 38.0 38.0 38.0 37.0 38.0 31 37.09575 38.0 38.0 38.0 37.0 38.0 32 37.119 38.0 38.0 38.0 37.0 38.0 33 37.21175 38.0 38.0 38.0 37.0 38.0 34 37.14875 38.0 38.0 38.0 37.0 38.0 35 37.0375 38.0 38.0 38.0 36.0 38.0 36 37.00925 38.0 38.0 38.0 37.0 38.0 37 37.0245 38.0 38.0 38.0 36.0 38.0 38 37.138 38.0 38.0 38.0 37.0 38.0 39 37.02575 38.0 38.0 38.0 37.0 38.0 40 36.9535 38.0 38.0 38.0 36.0 38.0 41 37.0755 38.0 38.0 38.0 37.0 38.0 42 37.0845 38.0 38.0 38.0 37.0 38.0 43 37.0635 38.0 38.0 38.0 36.0 38.0 44 37.07025 38.0 38.0 38.0 36.0 38.0 45 37.08 38.0 38.0 38.0 37.0 38.0 46 37.05 38.0 38.0 38.0 37.0 38.0 47 36.9985 38.0 38.0 38.0 36.0 38.0 48 36.93875 38.0 38.0 38.0 36.0 38.0 49 36.9915 38.0 38.0 38.0 36.0 38.0 50 36.92325 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 2.0 23 2.0 24 5.0 25 3.0 26 7.0 27 15.0 28 21.0 29 30.0 30 33.0 31 32.0 32 60.0 33 71.0 34 99.0 35 156.0 36 617.0 37 2830.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.06172499311105 10.856985395425738 8.239184348305319 36.84210526315789 2 24.54340755566675 12.184138103577684 32.04903677758319 31.22341756317238 3 22.7 13.125 24.474999999999998 39.7 4 25.900000000000002 18.35 21.85 33.900000000000006 5 27.270452839629723 23.54265699274456 22.39179384538404 26.79509632224168 6 25.6 27.250000000000004 23.849999999999998 23.3 7 19.575 25.95 34.675 19.8 8 20.65 25.275 29.025000000000002 25.05 9 21.7 21.725 32.875 23.7 10 21.5 32.1 26.05 20.349999999999998 11 27.175 24.675 22.475 25.674999999999997 12 21.825 22.7 26.025 29.45 13 21.95 25.55 27.0 25.5 14 24.275 23.25 25.05 27.425 15 22.525000000000002 24.625 26.75 26.1 16 23.400000000000002 24.95 24.55 27.1 17 25.275 24.825 25.2 24.7 18 22.575 23.65 26.625 27.150000000000002 19 23.7 24.224999999999998 24.525 27.55 20 23.974999999999998 24.975 26.8 24.25 21 25.2 24.2 25.55 25.05 22 23.1 26.85 25.324999999999996 24.725 23 23.275000000000002 25.575 26.174999999999997 24.975 24 24.025 24.45 24.825 26.700000000000003 25 23.150000000000002 24.474999999999998 26.174999999999997 26.200000000000003 26 23.25 25.900000000000002 25.05 25.8 27 22.55 23.400000000000002 26.450000000000003 27.6 28 23.625 25.4 24.3 26.674999999999997 29 24.6 24.425 24.725 26.25 30 23.5 24.325 25.6 26.575 31 22.975 25.85 23.849999999999998 27.325 32 24.15 25.05 24.8 26.0 33 22.900000000000002 23.474999999999998 25.424999999999997 28.199999999999996 34 24.7 24.3 23.849999999999998 27.150000000000002 35 24.45 25.374999999999996 25.0 25.174999999999997 36 22.425 24.725 26.05 26.8 37 24.55 24.625 25.324999999999996 25.5 38 23.275000000000002 25.874999999999996 25.45 25.4 39 23.125 24.75 24.825 27.3 40 22.925 25.8 23.225 28.050000000000004 41 23.625 24.625 26.25 25.5 42 22.825 24.775 25.775 26.625 43 24.45 24.45 24.6 26.5 44 23.25 24.8 26.075 25.874999999999996 45 24.125 24.125 25.4 26.35 46 24.175 25.1 25.924999999999997 24.8 47 22.525000000000002 28.449999999999996 24.099999999999998 24.925 48 23.75 25.6 25.174999999999997 25.474999999999998 49 24.575 24.8 25.025 25.6 50 23.925 24.75 24.05 27.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 6.0 26 8.0 27 13.5 28 19.0 29 22.0 30 25.0 31 41.0 32 57.0 33 61.5 34 66.0 35 101.5 36 137.0 37 168.5 38 200.0 39 202.0 40 204.0 41 235.0 42 266.0 43 291.5 44 317.0 45 316.5 46 316.0 47 317.0 48 318.0 49 305.0 50 292.0 51 286.5 52 281.0 53 282.0 54 283.0 55 247.5 56 212.0 57 186.5 58 161.0 59 165.5 60 170.0 61 158.0 62 146.0 63 130.0 64 114.0 65 108.0 66 102.0 67 90.5 68 79.0 69 72.5 70 66.0 71 59.0 72 52.0 73 45.0 74 38.0 75 31.5 76 25.0 77 25.5 78 26.0 79 18.0 80 10.0 81 6.0 82 2.0 83 2.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.275 2 0.075 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59349593495935 98.0 2 0.35569105691056907 0.7000000000000001 3 0.0 0.0 4 0.025406504065040653 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025406504065040653 1.2 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 48 1.2 TruSeq Adapter, Index 11 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820380 spots for SRR6322395.sra Written 820380 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra Read 820379 spots for SRR6322395.sra Written 820379 spots for SRR6322395.sra SRR ids: ['SRR6322395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t3f83g5o SRR6322395.sra spots: 16407581 blocks: [[1, 820379], [820380, 1640758], [1640759, 2461137], [2461138, 3281516], [3281517, 4101895], [4101896, 4922274], [4922275, 5742653], [5742654, 6563032], [6563033, 7383411], [7383412, 8203790], [8203791, 9024169], [9024170, 9844548], [9844549, 10664927], [10664928, 11485306], [11485307, 12305685], [12305686, 13126064], [13126065, 13946443], [13946444, 14766822], [14766823, 15587201], [15587202, 16407581]] SRR6322395 file size 2849000 SRR6322395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322395 SRR6322395_1.fastq Input file: SRR6322395_1.fastq trimmed: SRR6322395-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:02:12 2024 >> started Sat Dec 7 12:02:24 2024 >> done (11.942s) 16407581 reads processed; of these: 4306 ( 0.03%) short reads filtered out after trimming by size control 263624 ( 1.61%) empty reads filtered out after trimming by size control 16139651 (98.37%) reads available; of these: 133278 ( 0.83%) trimmed reads available after processing 16006373 (99.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 237 0.00% 19 291 0.00% 20 295 0.00% 21 355 0.00% 22 438 0.00% 23 543 0.00% 24 2273 0.01% 25 2792 0.02% 26 1510 0.01% 27 1632 0.01% 28 762 0.00% 29 887 0.01% 30 1581 0.01% 31 910 0.01% 32 838 0.01% 33 845 0.01% 34 966 0.01% 35 1104 0.01% 36 1194 0.01% 37 1366 0.01% 38 1565 0.01% 39 1937 0.01% 40 2226 0.01% 41 2784 0.02% 42 3318 0.02% 43 4343 0.03% 44 5713 0.04% 45 7725 0.05% 46 10313 0.06% 47 14734 0.09% 48 23588 0.15% 49 34213 0.21% 50 16006373 99.17% 16139651 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=22 prefix-density=0.10 prefix-fanout=2.4 sequence=GTTTCTGATCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=136.79 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=17.4 sequence=CTTCTTCTTCTGCTCCGGGGTGAACTCCGGCAGCCGTGATCCCACGAGGCCGCGCATGGTGGCCGGGTACTCGCCGAACGTCACGGGGTGCTGGAACCAGCCCAACATGAAGTCCAAGCTGCGCTCCTGCGCGCGCACGTCGGCCAAGGATTTCGGGTCGTAGGGCTCGAACCAGTTGGACACCTGCGTGATCCCGATCTTGCCGCCTTGGGTCTTTTGGTACTTTGTCCTGTAGAGCTCCACGGCCTCGGCGTGTGCGAGGAGAAGGTTGTGGCCTGCGATGTAAGGCTCTGTAGCTGAGTTTCCGGCGCCGCAGGTCTTGGAGACGTATGGGGAGCAGCGGCCCGGGGCGGCGATGCCCGTGGCGTAGCCGCCCGAGCAGAAGATCATTGGCTCGTTGAAGGTGTTCCAGAGCTTGATTCGGTCCCCGAATAGCCCGAACACCAGGTCCGCGTACTCCACGTAGTCCTTGATGATCTTGTCGCTGAGGAAGCTCCCGTACTTGTCCTCC Started job on | Dec 07 12:02:45 Started mapping on | Dec 07 12:02:45 Finished on | Dec 07 12:03:04 Mapping speed, Million of reads per hour | 3058.04 Number of input reads | 16139651 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 15408486 Uniquely mapped reads % | 95.47% Average mapped length | 49.73 Number of splices: Total | 2254822 Number of splices: Annotated (sjdb) | 2161269 Number of splices: GT/AG | 2228852 Number of splices: GC/AG | 21088 Number of splices: AT/AC | 1273 Number of splices: Non-canonical | 3609 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416553 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 213922 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 314612 314612 314612 N_multimapping 416553 416553 416553 N_noFeature 695421 15036614 802879 N_ambiguous 281571 832 19141 UnstrandedReadsAssigned:14431494 PositiveStrandReadsAssigned:371040 NegativeStrandReadsAssigned:14586466 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322395 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322395-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,139,651 reads, 14,435,399 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR6322395.ke.tsv 35125 SRR6322395.se.tsv 88098 total ==> SRR6322395.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 32.3536 4.42092 PNS24247 1044 945 31.7917 3.84766 PNS24249 1928 1829 24.0131 1.50159 PNS24246 1044 945 31.7917 3.84766 PNS24248 1044 945 31.7917 3.84766 PNS24244 1471 1372 82.2583 6.85711 PNS24243 293 194 0 0 KQK14069 1603 1504 9924.49 754.702 KQK14071 474 375 2781.67 848.379 ==> SRR6322395.se.tsv <== BRADI_1g14170v3 13561 BRADI_1g53295v3 134 BRADI_1g59795v3 312 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 3151 BRADI_1g74790v3 181 BRADI_1g09890v3 0 BRADI_1g77505v3 171 BRADI_1g48960v3 0 SRR6322395 completed mapping pipeline successfully