Starting /dee2/code/volunteer_pipeline.sh SRR6322396 current disk space = 1543605809152 free memory = 1602498628 SRR6322396 SRAfilesize 49f35abc769f79caf0c807559024eff5 SRR6322396.sra SRR6322396.sra file validated SRR6322396 is single end SRR6322396 is conventional basespace SRR6322396 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.385 34.0 32.0 34.0 2.0 34.0 2 32.124 34.0 32.0 34.0 27.0 34.0 3 32.32175 34.0 32.0 34.0 27.0 34.0 4 32.773 34.0 33.0 34.0 32.0 34.0 5 32.9265 34.0 33.0 34.0 32.0 34.0 6 36.86275 38.0 37.0 38.0 35.0 38.0 7 37.164 38.0 38.0 38.0 37.0 38.0 8 37.283 38.0 38.0 38.0 37.0 38.0 9 37.27675 38.0 38.0 38.0 37.0 38.0 10 37.3665 38.0 38.0 38.0 37.0 38.0 11 37.32325 38.0 38.0 38.0 37.0 38.0 12 37.376 38.0 38.0 38.0 37.0 38.0 13 37.3605 38.0 38.0 38.0 37.0 38.0 14 37.278 38.0 38.0 38.0 37.0 38.0 15 37.2775 38.0 38.0 38.0 37.0 38.0 16 37.26675 38.0 38.0 38.0 37.0 38.0 17 37.34775 38.0 38.0 38.0 37.0 38.0 18 37.34525 38.0 38.0 38.0 37.0 38.0 19 37.27875 38.0 38.0 38.0 37.0 38.0 20 37.2685 38.0 38.0 38.0 37.0 38.0 21 37.26375 38.0 38.0 38.0 37.0 38.0 22 37.299 38.0 38.0 38.0 37.0 38.0 23 37.22125 38.0 38.0 38.0 37.0 38.0 24 37.2525 38.0 38.0 38.0 37.0 38.0 25 37.33 38.0 38.0 38.0 37.0 38.0 26 37.21525 38.0 38.0 38.0 37.0 38.0 27 37.2315 38.0 38.0 38.0 37.0 38.0 28 37.19475 38.0 38.0 38.0 37.0 38.0 29 37.2285 38.0 38.0 38.0 37.0 38.0 30 37.142 38.0 38.0 38.0 37.0 38.0 31 37.164 38.0 38.0 38.0 37.0 38.0 32 37.07325 38.0 38.0 38.0 37.0 38.0 33 37.0905 38.0 38.0 38.0 37.0 38.0 34 37.046 38.0 38.0 38.0 36.0 38.0 35 37.067 38.0 38.0 38.0 37.0 38.0 36 37.13375 38.0 38.0 38.0 37.0 38.0 37 37.1745 38.0 38.0 38.0 37.0 38.0 38 37.17475 38.0 38.0 38.0 37.0 38.0 39 37.01975 38.0 38.0 38.0 36.0 38.0 40 36.9785 38.0 38.0 38.0 36.0 38.0 41 37.0785 38.0 38.0 38.0 37.0 38.0 42 37.18925 38.0 38.0 38.0 37.0 38.0 43 37.04575 38.0 38.0 38.0 37.0 38.0 44 37.092 38.0 38.0 38.0 36.0 38.0 45 37.14425 38.0 38.0 38.0 37.0 38.0 46 37.13925 38.0 38.0 38.0 37.0 38.0 47 37.02375 38.0 38.0 38.0 37.0 38.0 48 37.04725 38.0 38.0 38.0 37.0 38.0 49 37.05825 38.0 38.0 38.0 37.0 38.0 50 36.9725 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 2.0 25 3.0 26 8.0 27 18.0 28 17.0 29 23.0 30 33.0 31 38.0 32 48.0 33 72.0 34 84.0 35 176.0 36 818.0 37 2640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.20870076425632 7.054673721340388 7.2898295120517345 40.44679600235156 2 26.713356678339167 9.254627313656828 34.21710855427714 29.814907453726864 3 24.25 10.7 24.8 40.25 4 27.975 16.2 20.375 35.449999999999996 5 29.607401850462615 20.580145036259065 24.381095273818453 25.431357839459867 6 25.124999999999996 26.424999999999997 24.349999999999998 24.099999999999998 7 20.474999999999998 23.3 37.8 18.425 8 22.825 22.075 32.35 22.75 9 20.7 20.200000000000003 35.699999999999996 23.400000000000002 10 21.5 30.375000000000004 27.750000000000004 20.375 11 26.35 24.9 24.2 24.55 12 24.175 21.6 27.875 26.35 13 25.575 24.325 26.3 23.799999999999997 14 23.599999999999998 25.85 27.925 22.625 15 23.474999999999998 23.075000000000003 27.400000000000002 26.05 16 25.974999999999998 24.0 25.2 24.825 17 24.45 23.724999999999998 26.525 25.3 18 23.724999999999998 23.9 26.400000000000002 25.974999999999998 19 26.224999999999998 22.85 24.125 26.8 20 25.1 24.85 25.35 24.7 21 23.599999999999998 24.2 27.175 25.025 22 24.975 24.85 25.15 25.025 23 24.625 24.9 26.674999999999997 23.799999999999997 24 23.375 22.425 26.5 27.700000000000003 25 24.775 23.225 24.65 27.35 26 23.175 24.349999999999998 26.0 26.474999999999998 27 22.900000000000002 23.549999999999997 26.724999999999998 26.825 28 24.025 24.224999999999998 25.525 26.224999999999998 29 24.325 25.6 26.025 24.05 30 24.7 23.75 25.25 26.3 31 24.175 24.95 24.474999999999998 26.400000000000002 32 24.224999999999998 24.75 25.575 25.45 33 24.525 23.7 24.474999999999998 27.3 34 24.025 24.349999999999998 24.525 27.1 35 24.85 24.4 25.35 25.4 36 23.7 24.275 24.525 27.500000000000004 37 23.375 23.05 24.474999999999998 29.099999999999998 38 23.825 25.424999999999997 24.925 25.825 39 23.425 24.625 25.5 26.450000000000003 40 23.974999999999998 23.549999999999997 24.625 27.85 41 24.224999999999998 23.724999999999998 25.724999999999998 26.325 42 24.474999999999998 24.224999999999998 25.174999999999997 26.125 43 25.3 24.025 24.575 26.1 44 23.375 24.099999999999998 26.275 26.25 45 24.075 23.5 25.85 26.575 46 24.375 23.674999999999997 25.35 26.6 47 24.15 24.65 25.575 25.624999999999996 48 23.95 23.525 26.1 26.424999999999997 49 24.575 22.95 25.900000000000002 26.575 50 25.825 24.224999999999998 25.025 24.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 7.5 26 11.0 27 11.5 28 12.0 29 21.5 30 31.0 31 38.5 32 46.0 33 60.0 34 74.0 35 89.0 36 104.0 37 135.0 38 166.0 39 194.5 40 223.0 41 246.5 42 270.0 43 284.0 44 298.0 45 308.0 46 318.0 47 322.5 48 327.0 49 317.0 50 307.0 51 298.0 52 289.0 53 258.5 54 228.0 55 221.0 56 214.0 57 201.5 58 189.0 59 170.0 60 151.0 61 147.5 62 144.0 63 139.0 64 134.0 65 127.0 66 120.0 67 111.5 68 103.0 69 88.5 70 74.0 71 62.5 72 51.0 73 51.0 74 51.0 75 39.5 76 28.0 77 24.0 78 20.0 79 11.5 80 3.0 81 4.0 82 5.0 83 3.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.95 2 0.05 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24165824064713 98.15 2 0.7077856420626896 1.4000000000000001 3 0.02527805864509606 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 15 0.375 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra Read 1533586 spots for SRR6322396.sra Written 1533586 spots for SRR6322396.sra Read 1533583 spots for SRR6322396.sra Written 1533583 spots for SRR6322396.sra SRR ids: ['SRR6322396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x2p9ddtx SRR6322396.sra spots: 30671663 blocks: [[1, 1533583], [1533584, 3067166], [3067167, 4600749], [4600750, 6134332], [6134333, 7667915], [7667916, 9201498], [9201499, 10735081], [10735082, 12268664], [12268665, 13802247], [13802248, 15335830], [15335831, 16869413], [16869414, 18402996], [18402997, 19936579], [19936580, 21470162], [21470163, 23003745], [23003746, 24537328], [24537329, 26070911], [26070912, 27604494], [27604495, 29138077], [29138078, 30671663]] SRR6322396 file size 5335245 SRR6322396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322396 SRR6322396_1.fastq Input file: SRR6322396_1.fastq trimmed: SRR6322396-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:22:05 2024 >> started Sat Dec 7 10:22:24 2024 >> done (19.719s) 30671663 reads processed; of these: 5852 ( 0.02%) short reads filtered out after trimming by size control 180565 ( 0.59%) empty reads filtered out after trimming by size control 30485246 (99.39%) reads available; of these: 246399 ( 0.81%) trimmed reads available after processing 30238847 (99.19%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 371 0.00% 19 431 0.00% 20 420 0.00% 21 524 0.00% 22 650 0.00% 23 816 0.00% 24 4085 0.01% 25 4945 0.02% 26 2479 0.01% 27 2834 0.01% 28 1306 0.00% 29 1374 0.00% 30 2408 0.01% 31 1402 0.00% 32 1292 0.00% 33 1415 0.00% 34 1530 0.01% 35 1775 0.01% 36 2120 0.01% 37 2252 0.01% 38 2738 0.01% 39 3151 0.01% 40 3893 0.01% 41 4831 0.02% 42 6169 0.02% 43 8142 0.03% 44 10830 0.04% 45 14264 0.05% 46 19911 0.07% 47 27945 0.09% 48 44567 0.15% 49 65529 0.21% 50 30238847 99.19% 30485246 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=22 prefix-density=0.16 prefix-fanout=2.8 sequence=TCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=90.59 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=2.0 sequence=GGCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGCGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGC Started job on | Dec 07 10:22:38 Started mapping on | Dec 07 10:22:39 Finished on | Dec 07 10:23:01 Mapping speed, Million of reads per hour | 4988.49 Number of input reads | 30485246 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 29016775 Uniquely mapped reads % | 95.18% Average mapped length | 49.80 Number of splices: Total | 4434706 Number of splices: Annotated (sjdb) | 4243401 Number of splices: GT/AG | 4375088 Number of splices: GC/AG | 50369 Number of splices: AT/AC | 2790 Number of splices: Non-canonical | 6459 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 904091 % of reads mapped to multiple loci | 2.97% Number of reads mapped to too many loci | 389492 % of reads mapped to too many loci | 1.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564380 564380 564380 N_multimapping 904091 904091 904091 N_noFeature 1447757 28428917 1657776 N_ambiguous 420515 1646 44378 UnstrandedReadsAssigned:27148503 PositiveStrandReadsAssigned:586212 NegativeStrandReadsAssigned:27314621 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322396 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322396-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,485,246 reads, 27,213,119 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6322396.ke.tsv 35125 SRR6322396.se.tsv 88098 total ==> SRR6322396.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 166.446 10.8759 PNS24249 1928 1829 218.363 7.37209 PNS24246 1044 945 166.446 10.8759 PNS24248 1044 945 166.446 10.8759 PNS24244 1471 1372 53.3002 2.39883 PNS24243 293 194 0 0 KQK14069 1603 1504 30669.5 1259.17 KQK14071 474 375 17254.5 2841.16 ==> SRR6322396.se.tsv <== BRADI_1g14170v3 54639 BRADI_1g53295v3 519 BRADI_1g59795v3 685 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1022 BRADI_1g74790v3 548 BRADI_1g09890v3 28 BRADI_1g77505v3 423 BRADI_1g48960v3 0 SRR6322396 completed mapping pipeline successfully