Starting /dee2/code/volunteer_pipeline.sh SRR6322397 current disk space = 1543652892672 free memory = 1602439392 SRR6322397 SRAfilesize 494530329b65013d5292f4efb3da0c05 SRR6322397.sra SRR6322397.sra file validated SRR6322397 is single end SRR6322397 is conventional basespace SRR6322397 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34975 33.0 33.0 34.0 32.0 34.0 2 32.405 33.0 33.0 34.0 30.0 34.0 3 32.44125 33.0 33.0 34.0 30.0 34.0 4 32.3945 33.0 33.0 34.0 31.0 34.0 5 32.43 33.0 33.0 34.0 31.0 34.0 6 36.02575 38.0 36.0 38.0 31.0 38.0 7 36.61075 38.0 37.0 38.0 34.0 38.0 8 36.63575 38.0 38.0 38.0 34.0 38.0 9 36.772 38.0 38.0 38.0 34.0 38.0 10 36.9035 38.0 38.0 38.0 35.0 38.0 11 36.891 38.0 38.0 38.0 35.0 38.0 12 36.88675 38.0 38.0 38.0 35.0 38.0 13 36.8225 38.0 38.0 38.0 35.0 38.0 14 36.72775 38.0 38.0 38.0 34.0 38.0 15 36.68325 38.0 38.0 38.0 34.0 38.0 16 36.8555 38.0 38.0 38.0 35.0 38.0 17 36.7395 38.0 38.0 38.0 35.0 38.0 18 36.8185 38.0 38.0 38.0 35.0 38.0 19 36.6705 38.0 38.0 38.0 34.0 38.0 20 36.60275 38.0 38.0 38.0 34.0 38.0 21 36.68975 38.0 38.0 38.0 34.0 38.0 22 36.691 38.0 38.0 38.0 34.0 38.0 23 36.52575 38.0 38.0 38.0 34.0 38.0 24 36.588 38.0 38.0 38.0 34.0 38.0 25 36.52675 38.0 38.0 38.0 34.0 38.0 26 36.688 38.0 38.0 38.0 34.0 38.0 27 36.5585 38.0 38.0 38.0 34.0 38.0 28 36.5565 38.0 38.0 38.0 34.0 38.0 29 36.67475 38.0 38.0 38.0 34.0 38.0 30 36.72875 38.0 38.0 38.0 35.0 38.0 31 36.65025 38.0 38.0 38.0 34.0 38.0 32 36.6535 38.0 38.0 38.0 34.0 38.0 33 36.72225 38.0 38.0 38.0 35.0 38.0 34 36.77375 38.0 38.0 38.0 35.0 38.0 35 36.67 38.0 38.0 38.0 34.0 38.0 36 36.6325 38.0 38.0 38.0 34.0 38.0 37 36.5005 38.0 38.0 38.0 34.0 38.0 38 36.59075 38.0 38.0 38.0 34.0 38.0 39 36.63475 38.0 38.0 38.0 34.0 38.0 40 36.5685 38.0 38.0 38.0 34.0 38.0 41 36.6345 38.0 38.0 38.0 34.0 38.0 42 36.50325 38.0 38.0 38.0 34.0 38.0 43 36.68025 38.0 38.0 38.0 34.0 38.0 44 36.59675 38.0 38.0 38.0 34.0 38.0 45 36.41675 38.0 38.0 38.0 34.0 38.0 46 36.275 38.0 38.0 38.0 33.0 38.0 47 36.3225 38.0 38.0 38.0 34.0 38.0 48 36.3295 38.0 38.0 38.0 34.0 38.0 49 36.34925 38.0 38.0 38.0 34.0 38.0 50 36.2275 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 5.0 22 2.0 23 3.0 24 9.0 25 11.0 26 23.0 27 20.0 28 50.0 29 38.0 30 61.0 31 71.0 32 80.0 33 139.0 34 171.0 35 274.0 36 536.0 37 2500.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.89367598891408 14.411690602166793 7.634164777021919 40.06046863189721 2 26.174999999999997 21.075 32.2 20.549999999999997 3 22.925 25.85 20.200000000000003 31.025000000000002 4 28.075 30.9 18.125 22.900000000000002 5 26.331582895723933 32.0830207551888 19.72993248312078 21.85546386596649 6 21.099999999999998 31.374999999999996 20.525 27.0 7 19.175 16.825000000000003 38.05 25.95 8 22.6 17.9 25.974999999999998 33.525 9 22.225 18.125 28.299999999999997 31.35 10 26.174999999999997 31.025000000000002 18.975 23.825 11 29.075 19.175 18.825 32.925 12 28.000000000000004 16.975 21.65 33.375 13 24.275 22.25 24.425 29.049999999999997 14 24.025 24.3 24.349999999999998 27.325 15 25.825 23.05 23.575 27.55 16 25.7 23.724999999999998 22.275 28.299999999999997 17 24.575 24.725 23.925 26.775 18 25.156289072268066 22.95573893473368 24.831207801950487 27.056764191047762 19 25.624999999999996 23.75 24.125 26.5 20 24.474999999999998 23.175 24.45 27.900000000000002 21 25.1 23.25 23.175 28.475 22 24.9 24.875 22.775000000000002 27.450000000000003 23 25.174999999999997 23.9 24.3 26.625 24 24.175 24.275 23.9 27.650000000000002 25 25.575 24.325 22.35 27.750000000000004 26 25.35 23.724999999999998 24.575 26.35 27 24.731182795698924 23.1807951987997 24.256064016004 27.831957989497376 28 25.45 24.275 22.75 27.525 29 24.349999999999998 23.65 24.05 27.950000000000003 30 23.724999999999998 23.7 25.6 26.974999999999998 31 26.625 22.5 23.1 27.775 32 24.975 25.45 23.674999999999997 25.900000000000002 33 25.224999999999998 23.525 24.2 27.05 34 26.575 22.925 23.425 27.075 35 25.85 24.2 24.025 25.924999999999997 36 24.825 23.400000000000002 24.474999999999998 27.3 37 26.400000000000002 23.549999999999997 23.3 26.75 38 25.4 23.9 23.599999999999998 27.1 39 24.55 23.75 24.099999999999998 27.6 40 26.474999999999998 22.975 23.849999999999998 26.700000000000003 41 25.775 23.674999999999997 23.200000000000003 27.35 42 25.650000000000002 22.8 24.075 27.474999999999998 43 25.3 23.825 23.799999999999997 27.075 44 25.174999999999997 24.375 24.3 26.150000000000002 45 24.65 22.45 25.4 27.500000000000004 46 26.775 23.474999999999998 23.45 26.3 47 26.025 24.0 23.25 26.724999999999998 48 26.650000000000002 22.325 23.549999999999997 27.474999999999998 49 26.1 23.325000000000003 23.05 27.525 50 26.0 24.825 21.675 27.500000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 8.0 26 13.0 27 13.5 28 14.0 29 17.0 30 20.0 31 26.5 32 33.0 33 51.5 34 70.0 35 78.5 36 87.0 37 111.5 38 136.0 39 169.0 40 202.0 41 225.0 42 248.0 43 236.5 44 225.0 45 251.0 46 277.0 47 279.5 48 282.0 49 271.5 50 261.0 51 276.5 52 292.0 53 254.0 54 216.0 55 224.5 56 233.0 57 228.5 58 224.0 59 198.5 60 173.0 61 168.5 62 164.0 63 156.5 64 149.0 65 138.5 66 128.0 67 125.5 68 123.0 69 116.5 70 110.0 71 102.0 72 94.0 73 88.0 74 82.0 75 68.0 76 54.0 77 44.0 78 34.0 79 31.0 80 28.0 81 18.5 82 9.0 83 9.0 84 9.0 85 5.5 86 2.0 87 1.5 88 1.0 89 1.5 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.025 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62909367859864 97.125 2 1.2693577050012692 2.5 3 0.05077430820005078 0.15 4 0.02538715410002539 0.1 5 0.02538715410002539 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra Read 1157717 spots for SRR6322397.sra Written 1157717 spots for SRR6322397.sra SRR ids: ['SRR6322397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0m8wobt_ SRR6322397.sra spots: 23154340 blocks: [[1, 1157717], [1157718, 2315434], [2315435, 3473151], [3473152, 4630868], [4630869, 5788585], [5788586, 6946302], [6946303, 8104019], [8104020, 9261736], [9261737, 10419453], [10419454, 11577170], [11577171, 12734887], [12734888, 13892604], [13892605, 15050321], [15050322, 16208038], [16208039, 17365755], [17365756, 18523472], [18523473, 19681189], [19681190, 20838906], [20838907, 21996623], [21996624, 23154340]] SRR6322397 file size 4025062 SRR6322397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322397 SRR6322397_1.fastq Input file: SRR6322397_1.fastq trimmed: SRR6322397-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:23:30 2024 >> started Sat Dec 7 10:23:44 2024 >> done (14.523s) 23154340 reads processed; of these: 4126 ( 0.02%) short reads filtered out after trimming by size control 29197 ( 0.13%) empty reads filtered out after trimming by size control 23121017 (99.86%) reads available; of these: 498684 ( 2.16%) trimmed reads available after processing 22622333 (97.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 371 0.00% 19 423 0.00% 20 531 0.00% 21 596 0.00% 22 805 0.00% 23 920 0.00% 24 1136 0.00% 25 1522 0.01% 26 1505 0.01% 27 1686 0.01% 28 2119 0.01% 29 2875 0.01% 30 12587 0.05% 31 6910 0.03% 32 5315 0.02% 33 5031 0.02% 34 5202 0.02% 35 5335 0.02% 36 6115 0.03% 37 6614 0.03% 38 7436 0.03% 39 8765 0.04% 40 10335 0.04% 41 12095 0.05% 42 14844 0.06% 43 18657 0.08% 44 22721 0.10% 45 29531 0.13% 46 39053 0.17% 47 56476 0.24% 48 86929 0.38% 49 124244 0.54% 50 22622333 97.84% 23121017 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=60.98 fanout-score-rank=4 prefix-density=0.39 prefix-fanout=11.9 sequence=CGCCGCCGCCGCGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=288.14 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=15.1 sequence=GCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCG Started job on | Dec 07 10:23:55 Started mapping on | Dec 07 10:23:55 Finished on | Dec 07 10:24:17 Mapping speed, Million of reads per hour | 3783.44 Number of input reads | 23121017 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21644914 Uniquely mapped reads % | 93.62% Average mapped length | 49.80 Number of splices: Total | 2983500 Number of splices: Annotated (sjdb) | 2868351 Number of splices: GT/AG | 2946726 Number of splices: GC/AG | 30024 Number of splices: AT/AC | 1409 Number of splices: Non-canonical | 5341 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464340 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 876675 % of reads mapped to too many loci | 3.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1011763 1011763 1011763 N_multimapping 464340 464340 464340 N_noFeature 781219 21144615 979374 N_ambiguous 317427 1364 15631 UnstrandedReadsAssigned:20546268 PositiveStrandReadsAssigned:498935 NegativeStrandReadsAssigned:20649909 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322397 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322397-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,121,017 reads, 20,440,320 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR6322397.ke.tsv 35125 SRR6322397.se.tsv 88098 total ==> SRR6322397.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 31.5 3.10402 PNS24247 1044 945 7.78658 0.6796 PNS24249 1928 1829 124.14 5.59806 PNS24246 1044 945 7.78658 0.6796 PNS24248 1044 945 7.78658 0.6796 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 9.32507 0.511379 KQK14071 474 375 1.67493 0.368388 ==> SRR6322397.se.tsv <== BRADI_1g14170v3 11 BRADI_1g53295v3 13 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 941 BRADI_1g20270v3 3882 BRADI_1g74790v3 10 BRADI_1g09890v3 43 BRADI_1g77505v3 87 BRADI_1g48960v3 0 SRR6322397 completed mapping pipeline successfully